Description :
From Genome Similarity Track
Location :
Scaffold_21:31310- 33784
Sequence
2474 bases(100 bases per row)
AGGTTCAGTATCTCTGCAACCTCTGGCAACGGTTCCAAGTGGACACCAGATGCCTTGACGGATAAACCGGTCTCGCCATCGAAGATGTGATAACACTCTT
CCACCGGCCTTGTCGGAGGAGCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACGTCGATCTGAACGAAGTTCGGATCCGACTTGAGGCGGCGGCGTCG
GCGTCGTCGTCGACGGCGACCGTGACGTGGAGCTTTGCTGCCCACGTCTGGGGATGTCGGCGCTCTGACATCCGAGGCACTCGTGGCCTCGTGTGGTACG
GTGGTACCCACACAGGAAGCGTGTCCGACACCTTCCGCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTCTGTTACCCACACAGGAAGCGTATCCGA
CGTCCTCCTCTTCAGTTAAGGTCTGGGCGACCGTGTGTGGAACTCTGTTACCCACTCCGAACACGCTGTTGTCAGTGTTCGTGACAGCTGCATCTGTCTG
CGGAACTAAGTTACCCGCTTGTGGACCTAAGTTACCCACTTGGCCAGCGCCTCTTCTGGGCGCTGCCACCATCAATGCATCCTCGGATCCGTCATATACG
TCGACGACCCCCAAGCATCTGCCGATTGCTTTGGTACCCTGGCAGCCCTTGCGGGCGCCCCGGGTCCTGACAGAGGTGGGAACATGACTCACCAATGCTC
TGTCGGACTGCGCAGGGCGGCTGGCACCGATTGCCTTACCTCGCCAGTCGATACAGGGCTCGTGCTTCTCAAGCCAGGGCATGCCCAAGATCCTATTGTA
AGAATCCATGTCGAGAACAGTAAACTGTTCAAGGCTGTCAAATTCTTCAAACTTGACTACCAGATCCACTTGGACGTTAGGGACAGTGACGACCTTCCCG
TCACCAGTCGCACTGACACCGTCCCGTTGCCCTTGCTTTCTCTCAAAGCATCGGACAACTTGTTGCTATTACGAGAAACCGTCTGGCGGGGTGCGAATTT
CATCCACGCCCCAGAATCGATCAAGATTCTAAAGGAAAGATCGTATCCCCGTACACATCCGTGTACTATGAGCAACCCGCTACTGCTCTTCGCCGATTCG
AGAGTGCGAAGCCTCTCAGGGGCTAAGTCCCCGTGGTACGCGCCACCCGCGCACCCATCACGAAGACTTAGTTCTTCCCCAGTAGGGCGCCCCGCCCCTA
CTGATTTCCGGCGTTCCCCTGTCCCCGGGATCCTGGCTTCTGTCAGCGACCCTTGAGGACGGGCTTGGGGAAGGACCGTCTGCGGAGCCTTTTCGCGGGA
CAGTCGTGCTTGAAGTGGCCCATCTTCCCACAGCTGAAGCAGCGGATGTCACGCTGTTCGGCGGACCCGAGTTCCATGGGAACTGGTCCGTTAGGGCTTG
TTCGACCGGGAGCCGACAAGGAACTCCCAGTCCACGCTAAGGCCGGCGTACGCGCCTGGCGATGGCTGTACTCTTCTTGAAGAGCCACTTGAATCGCCTC
TTCAAGGGTGCTTGACTGCACCCGGAACAGCTGAGTGCGTGCGGGGCCCACTCGAAGGCCATCCATAAACACAGTCATCTTGATGTGTTCATTGAGTGGG
TTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTCTTGCACATACTCGTGCAGTTCGCGCCTTCCTTGTTTACACGCGAGGAAGCGCGAACGCTGGCGGT
ACTCGTAGTTCGCCGGGAGGAACGCGGCTCGGAGTTCGCACAGCTGAGCCCAGGATGTGAAACATCCAGGGGATGTTGCTTCCCGAGTGTACACCCAACT
CTTAGCACGACCGCTAAGGTTGGAGAGTGCAAAAGCAACACGCAGTTGCTTGGTCGAGATCAGAGCCGCGTCCATCGCGAGCTCTACTTCTCGGACCCAG
AAGTGAAGGTTCTCGCCTTCCTTCCCTTCATACGGCTTAACCTTCAGCCGTATTGGCTTCGGGTGAGGCGGATTTGCTTCCGCCGCCGGAGCCTGCAGGT
TCTCCCGCACATGCGCGATGAGGCCCTGCTCGTACGCGTCGAATGCATTGACGCGCTCGAGCTGCTCAGCCGGTGTTGATACCACCAGGCTCTGCAGGGC
CTCCATCCCGAAGATGCCTGCCATCTTCCGAACCGACTCGAACTGAGAGTCGTTCATATGGGAGAAGTCGTTCCTATCCATGGCAACGAACTTCGGAGGT
TCAGGTAGTCTACCCGCGATGGCGTGGATTGACCAACAAGTGCTACCAAGTGTGACTGGGTCACACAGCACCTTGCGCTAGAGGAAGTTATCTTCCGAGA
GTATACAAACTCTCAGTGAACGGCAGTTCACAGGTCCCCTCTTTAATTAAAGAGAGCGAAGTGACCTAAATAAGGTAGCTTGTAAACTGAGTATATTTAT
AGGTAGGTTAAGTTTGAGGTTAATACAAACTATCAGTTATCTATAGTAATGCAATGTCATTTAACCAATGGTTG