Description :
From Genome Similarity Track
Location :
Scaffold_32:313089- 320219
Transcript NameFunction/comments
Phyca_LT153417988microtubule-associated protein, putative
Phyca_LT1534117155microtubule-associated protein, putative
Phyca_LT1534549386predicted protein

Sequence
7130 bases(100 bases per row)
catgggcaacgcgttcctgctggcggctgtgaaggaccgacaggctgtggcactggctgacgctattctcccctttgacaacttgcagttgcatgagatt
gagacgttttggcgcgcgttctacgactcagcgacgagctttgcgctgtccaagagccaattccgcagtatttgctgccgcgcagtctccttgggtgttt
ctagcctgcaaagctctcattctagagtcgcagagtatgctgatgctgtatttgagctgtttgctgacccactggcagagaaacgatggcagcaatcaca
gctagggtctcgaggactgcagagccagcagtaccagaattcgaacgacagtttggcagtgatcgacgcactcgagttcctgtcagctattgcgttcatt
gctgctatcccactagacgaaaaggttgacttactgtttgactcatgggatatgtctgaggacggagccttggatttggacgagtttacgatttctttaa
agtcgacgctgtcgggactggctaagattcttcaaccgaattttagcaacacggcgatgagcctggaaacgacggtcgatgaggaggaaattataatgct
tgctgaggcgacatttcgggagataggtagctgtggtggtgtttcactgtcaaaggataaaggatccgaggcggacttagctacaatcacatgtgaacaa
ttccgggaattcagtttaaagaacaagcgagcaaaagagctctttgacttgttcgatgtggcaggcgccagcaatgggcaacatgaccctgatttcatcg
tggaagggggacccttggagaaagcagaaactgttgacctggtgactaaacttgaaagacactcggacctccctgactcttcgacggtcgtcaatacttc
gttggacgttacgcaggatgatgttggcgacatgtttctagctgtaaaaccatggatcggagcgattgtgcctccaagcaaaacccccgtgttatccaaa
ggagctccgttggtttcaatcaagctggattggattttcggctatagcgcgcaagattgcaagaacaacgtgcgcttcgtaacaacgacagccaatgcta
aggctggacgcgtcgaagaaattgtataccctgctgctggggcttgtgttgtattaaataccaaagcgatgaagcagcgccatcaacttgctcacacaga
cgatgtattgagcttgtgcctgcacccacgtctccccctagcagctagcggtgaaattggcaagcaacctaaaattattgtgtgggatctggattcaatg
gaggtacagtgtatcttgcaaggttttcacaggcgtgggatcttacaactagcttttctgagccctgagttgctggtgtcaattggtggagatgacgatc
acagtattgcaatctacgagtcgagcagtaactggaaatctgcagtgctgaaaatatcagtaaagggcaacaaagcactcccatttcacgtcactacaaa
tcctcgcgttccaaatgagtttgtcacgtgcggtcaaaagtatattgagttttggtccctcgaagggaaggagctcgcttcgaaaaagggtttgctgggg
aagaagggatcacttcagccatttcccgtcgcccaatatctcgaatcagtggatcaggctgttgtcgttggaaccagcgatggtttcttgtatctttttg
ttggaaggcagctgacaaacgtggtaaaggcgcatgatggagcaatcactgctttatcttattcttcaggaacgctactgtcgggagcccgagatggcca
aatcattcagtgggatgacaagttgaagcaaatttgtactgcaatccagatccaggattctcttgattcctcctcacttcctcaacgcaagggcatacga
agttgctgttattctccagatagacgaaccattctcgttggcacactcgcgtcggaaatttacgaacttgatgcgaagtcaggacagaatatgcacttag
agcctcttactaaagggcattttctgggagaactgtgggggttggatgttcaccccttaacgcagcagtgttgtactgtcggagatgaccaaaccctccg
catctgggatttggcagcgcgccacgagctgggattcctagagttaccaataccaggacgtgcttgcgcgtactcgggtgatgggaaattaatcgcggtt
gggcttggtactgaggactctgggaaagcaaaggcagcagtcaatgccaagaaacgacaacccaacggaggtttcgtggtgtacagcgctatcgacttga
cttgtgttaaagagccctgttttgatgcgaagaggtgggttagtgatgtaaagttctcacctgacagtcgaacactggctgtggcgagccacgactctaa
aatctacttgtacaatgtgctgaagggatactctcggactcatgtattcaacaagcactcgagctatatcactcatgtggacttctcactggatggaaat
tacttgcagagtacttcgggaggatatgagctgctattcaccgaagttaagacaggtaaacacatcacgaatgcttctacctttcgagacgagttatggc
atacaatgaccagcacgctgggatggtcggtgcaggggatttgggaaccagagagtgacggaactgatgttaactctgttgatcgctcttgtaacgggaa
attgttggtatccggcgacgataatggaaaggtgaagattttccagtacccttgtgcgttggaaaaggcttcttttcttgagttgcgaggccacgcttct
catgtcacgaaagtcaggtggtcaattggcgacaactacatcgtttctataggcggaaatgatagatgtgtctttgtttggggccacagcaggcaagccg
cgggaaaggataatttcaagcgacgtattagtgaaacgagtagtgaaagtgatggaatcgacttactggataagagggctgaagatccgttggaggtaat
ggctatgaatgatgatatcggggatgagtttatggctgtacgaccgtggcttggggctgtagtggccccttcaaaagctgtttcaatgaaggtggacagc
agatctccaagtacaagactcgagttggagcgagtacatggctatcaggctcaaacagcttccaataatgccagatatgactcaagtggcaaagtggtgt
atcataccgccgcactgggagttgtttacgacaaagctactcaacgccaagcgttcttcaaaagccatgacgacgatgttgtggcgatgtgtgctcatcc
ggacggaaaaaccttcgcaacttctcaaatgggaaagaaaccaaagatttacgtctgggactcgggaagcggagaagcggttgcaccttgtcttgaagga
tttcaccagcgttttgtgaatgcaatttgcttttcgagtgatggtacgaaactaggcagcgttggtggtgatgatgatcactccattgcaatttacaatt
ggaagagcgcaataatggtggctcaatctcgtggagaacgaaataatgtgcgtggtatctgctaccacgctgctactaaggaatgggtgacatgtggtga
caaacatattcgtttctggactgagcaaggcatgaatcttacttcaaagaaggcaattttcgggactaaggcatatcaaaacgggaaggtgccgtcaatt
tttgactgtgtagtatcgtttggacaaatgataattgccggggcttcgactggtcatctcatggtatttcaaagttctatggaggtaactaaagctatcc
aagctcatgacagtgccgtattagctctctacgcttcggaacgtgaactgattagcggcgggaaagactccaagatagtcgtgtgggacgcgcaactcaa
taaggtggctgtttttgatatgaaagagcacacactccaaggagctaaacttttaaattctgagattcgaagtgtttgctccagtcgagtttctccccga
gttttcttagttggaacgggaggcagcaatttgttcgaattcgatgctggtcggcctcaaccaacgctgtcaacaatcacgtgtggccattgtaagatgg
aggtgtggggtctcgcttgtcaccctacgaaagctgagtactgtactgtgggtgatgatcagactattcgcgtgtggtgtttgctcaaaaagaatcaact
gcgagttcagagacttgaatgtgttgcacgcgcgtgtgcactaacagattcggctgacattgtcgcaataggatttggtggacgtaacgcagtcactggc
ctttcgaaggcagctcaagctaaaacagggggtattgtgatactctgctatactgatttgacgaaaaaggtctttgacgaccggccatcaaagcaagcta
ttagcgaaatgaagttttcaccaaatggctccgtacttgctgttggctcacacgaccacaaaatctatctctatcgcctggaacgaaatgcaacaaaagt
cgtgaaggcagcagtcttcgataggcaccaaagctacatcactcacttggatttttcagcagacggtcaagtgttacaaagcaactgtggtgcctatgaa
cttctctttagtaatgccaccaccgggaaacatatcacgtctgccagcagcacgaaagatactccgtggcattcctggacgtgtgtactggggtggcctg
tgcaaggtatttggccaccgtgctccgacggcaccgacgttaatgctgtcgcccgcaactcacgcgaaacccttttggtcacttcagatgattttggtct
tgtcaagctttatcgatatccttgtgtggcaaagaatgcgagctctgtagaccatcgcgggcattcatctcacgttaccaacgtccggtggtctcatgac
gacagctacgttataagtgttggtgggaatgacagatcggtcatggaatggcgagtgctggatgagaatggaggaatcccaccaggtcctggcccaggaa
aacaattcattcaaacggagccagaagacacgacggattcgtcggtagaatcagaggaggagtattttgatgactcggtggtgggggatgagttcatggc
tgtaaaaccttggattggagcaatcgttgcccccacgaatgctgcgacgccgaattcacgtgagccagacttgactgttgaactggaatgggtttatggc
tatcaagcagaagtatctcaacagaatctgatgtacaatgcccaagacgagatcgtttaccacacggctgcggtggggatcatctatgatcccctgaatc
atctccagcgacatcacatagggcacaatgatgatgttatcagttttgccatttgcgatccaaaacgaaatctcattgcaacaggagagcgcgggaagaa
gccagctttgagggtttgggatgctcacacgggtgagttatgctgtgaaatgaaggaattccatacgcgtggaattttgtcggttgcctttagcaatgac
tcgacaagactcgtcagtgtgggggacgatgatgaccactcactggctgtttggggtgatgcaagcaacggatcgtggaagttggcgaaacttctggcta
ctggaaaaggtgataaggcggtgaatcgcttcgcgtgtttcggggcaaatgcagattccattatcactggcggtgtcaagcacgtgttgttttggtctat
ccaaggtaaaactctcgtctcgaagaaaggggtcgttgggaagaaaggaaccctgcagcttttcccgacaggctgcaactttggaggagactttatcaca
ggtactgcaggcggcgagctgtatgtatggagaggcaatgatcttatgagaacagtgaaggctcatgatggagaagtccgtgttgttgccagtaccaact
caactgaaaatcctgccgcgaattcccccgttctgttatcaggcggaaaggatggtcgtgtggtgatgtggaactcgtcgtaccaatcgctcaagtgttt
cgacctggacgcgatgcacgtggggagtttcggtaaaggtatcaacagtgtttttctaaactcaacaggtagaaaactgcttgtgggcacctcctctagt
gacattatcgagatcgatgtggcaagtggaggtgttttaaacggtgggcagccgctattctccggccacttcgcgatggaactatggggactagcagtgc
atccttcacagcgacagtttgtcacagttggtgacgaccgaacattgcgtgtgtgggatatggagtcgaagcggttgattcaggcacgtttactccccgc
aaaagccagagcatgcgcatactcacctgattcggagctactcgcggtaggctttggtggtgacaatggagttagacagagaaagaagccggcactgaaa
ccaggacaagcccaatcgaaagaaggaggggttgctatcttgcggacacacgatttgacactgagaagctggtgtttgaggacaaaccggcaaaggaatg
gatcagtgacgtgaaattctcgcccaacggagaagttttagcacttggttctcatgacaactcgatctatctctattcggtgggtgccggagcacaagag
ttcaaaaaacgcaagccattcagcaaacacaacagctacatcacgcactttgacttttcagatgacagcaactacatacagtcgaactgtggcgcctacg
agtacctgttttgcgatacagcatccagtaatcaagttggcagggcttcaactgtgcgagatgtcaagtgggcaacctggacatgcacattaggatggcc
tgtgcagggtatttggcccgaatgcgctgatggaaccgacatcaatgctgtatgcgcgtcttcatcacgcacaatcctcgcatccggtgacgactccggc
aacgttaagttctttcgctacccatgcattccaaaaggggtacgtccagcgatgcttttacctcccctgcatacatttaacatcgtgttgtgaattccat
agtcgaaatttatcgcgtgcaaaggccactcctctcacgttgttaacgtgcgcttcagcttcgacgacaagtatctcatctcagtgggaggaaacgacag
gtcgattttccagtggaaactagcgtagtc