Description :
From Genome Similarity Track
Location :
scaffold_25:313076- 315954
Sequence
2878 bases(100 bases per row)
GTATAGCAAGACTTGGGAAGACGAATTGCGGCGAAACGTGCTTACGACGTCCGAGATTAAAAAACCTTGCTTTACAAAGCTTTCGCCAGCGCAAAATTTG
TTGCACGTCGGAAGTAAAGTCGATGTGCGATATTTCGGAATCTGGGCGACGCGAGCGCGCATTCTATCGCGTTAAGCTAATAAATAATTTCTAACCTCGC
AGGTATACCCAAAAAGAATGATAGTCGATTTGCTTTCTGTTAGAGAGATGAGAAAACGTTGGCACTGTGCGAAATGACTGATGAGCTGTATAAATCACAG
ATATCTTTGTGCGAAGTAGGTGTATCATGAACACGATAAGAACGTCCTTCATAGCAAGCAGGAGTTTATACCATGGACCGGATCTTACTTTGCTGAAACT
TGATGCCGATATCGATGGCCAGATTAAAATTTTCCGTCCTATAATCCAACATGTCGTCAAAAACAGCTTATTCATAAGCGCGGTGAGACACAAAAACCGC
ATAACTAGACCATTAAGAGTTGCTGGTGCGTAAGACATCTCTTAGGGCCACTGTTAGATCATCTTGCTAAAATTAATAATTATACCGAGAAGGATATCTC
TGGTTATCATGATTGGTATCCCAATGCGTCGACCAAATTGCTAGCGCGGTACAGAGTACAAATGAAGATGCAGTTTTTCACGATAATCTCTCAAAAAATG
ACGTTTACGTTGGAATGGTGGATGCATCTATATCGTTGAACGCTTGCATAAGTTGCGACCTGCCGCTTGACTTTCTGATGCAGAACGTTGGCGCCAAGTG
GATACATTCAATCGTCCTTACCAAACCCGCTTTGAGCTTCGGACGAGAAAAAGCGTAAAGTGAGGGCCTATCACATGTACACTACATTTGATTCGGAGAT
TCAGATCGGTTTTCATGATAAACTCGCAAATCTGAGGACAATGTTTTGCTCTCACAGGTAATAGATTTTCACGACTCGGTGATTGGATTTACTACAAGTT
TAAAAAAGTACATGGGGTTTACCCAGCACTTCGTACAGAGATATTCCCCCGCATTAACAACACGATAGGTTAGATCCGTATTTTTGCTTAGGAGCGTATT
TGACAGCTTCGAAAATAAGTAAGTCTAAGACCTGCTCTTATTTGATAACATGAAGGACAAGAATTCAAATTCAAGTGTGTTCAAACAAGTACTAAATACA
ACTGTTTACATTCTTTGATGTTGAAATTTATGTACTGCATGATGTGAGGCTGACAGCCCACGAACCTCTAACTTGCGGAGTGCCATCCCTCATCAGTACC
AGAATTTTGGTATATACTAGATGTGCGAAATGCACAAAGCGTAAGGTGCACATACACAATAGACAGTGCATATCTTTTTTCAGCCCCCCCCCCACGAGAT
GTGAACTACAACGTGGTCCTCGCTTGATTTGTCTCTTTAAACATTGCACCAAAATGAATGCCCAGCGATCCCCCATTGCTTGAAGTTTCGCCCAACTCTT
TGCACCCTATGCTACTTTCTCTTACAAGCATAGATCTGTCCCGTACTTAGATCAGCTGGCCGTTAAAAAAGTTGGTGTTTTCCTGCCGACAACCTTGAGA
TCATTCTTGGTGAGGATACTGAGTTAAATAACGAGGAGAACAGTTGTACCTTCGCCCTAACTGAGAGACATACGGCAGCATTGTGAGATGAGGAAGAATT
TCTCTACGTCTCGCCCCTTTCGTGCACTAAAGAACCACTTTGTACGCCTTCCTTCTGGCGTAACATTTCCGACAACCCATCACGGCAGCGTCCGACTCGT
CACCGATGAGCCGGACCTGGCTCAGCAAGCGAAGACTTTCCGTCTGTAAGCGCAAGTGTTGCAACGACTTTTGCTGACGTGTTTGGTTCTGCTGTTCAAG
CAGAGAGCCCAAACGTTAACAACCCTCACGACTGCCACCAGACCTTAGAGCAGTAACAGCCGGCAAATTGTTACTCCTCACGCGGGCTGTACCTTGAGTA
TTGAATGCTGCCAAAAGTGCCGAGGAAAATCAAACGAATTTCGCACACTGGGTGAGGAAGACGCGTCGTCGCCTCCATATCACAGCTCTTGAAATTAGCT
TAAGTGAGGCAGACACCCGACAAGAGCGTCATATGCTGCTTGCCTTTGCAAACTTCATATCACTACGTGGATGGCAAAACTGAAATCCATCAACTTAGTT
TCTGCTTTCATCAACCCCACTCATTCCACGAGACGGCTGCAATATTTACCTACCGGGTCCCGAATTTCAGACAAGGTCAGGCCTTATTCGCTCGTGGGGA
GCGTCGTAGATGAGCAACCCATATAGGGTCATGGAGAATGAGAGTGCACTATAGCCTGTTCCACAGTTGGCTCTCTTTAACTATCATACGTATGGTGGTA
CGGCGAAACTCTTCGATTATTATGGCGTGTGGCCCTTACTGAAATGAGCCATTTCTCAAGTGCGCTCTCTGAACTACGCCCTTGCTCTGAAAAGCTTGGA
CTGCCTTCCTCTGTTCAGACAAAAGGCGCTACACAGGCAGCGGGGAGCTCAGCTACAAATATAGCTGAAGCGTTTACTCTTTGTTTATAGAGCGTTTATA
TTCGTTTGATCTGTCAGAGCGGGATCATAGTCTGGCTTTATCGACAACACGCTGAACATAACATATACAATTGTATTTGATATTGAGCGTGAAGTCTTTT
CCACATCGGTACCGGCCCGATGTAGCTAGGTCGTACATTAGTTACAACGATCGCAGAGCCTGGACGTGTACGTAGGCAAAACGTGGCATCCACACACCGC
ATTTGCATATTCCGCCTGCCCTTAGCATCTGCATGTTGCTTTGCAAACTTAGAATCTCAGCCATAGCGTTGGGCACTT