Description :
From Genome Similarity Track
Location :
Scaffold_50:313050- 316609
Transcript NameFunction/comments
Sapdi_VS20SDRG_12523hypothetical protein

Sequence
3559 bases(100 bases per row)
CTCCTTCTTGGACCCAAGCGTGCGGAACGTTGAGCCTCTTGGCTTGGACGACGCTGATGTTGGCGCCGACGGGAGGCCGCTGTGCGCGCGCAGCTTCTCG
AGGTCCTTTTGGAGCTGCGCGATCGTCTTGTCCTTCTCCCGCGACTAGACACACGTGGTTTAGGTCTATGAGTGTAGTGACAGGTGTGTACGAGGTCGTC
TTGCTGGCGCAGCTTGAGCTGGTGCGTCGCCAGTAGCATCTCCTTTTCCTGCTTGAGCTTGTCGCACTCGTCCCGCATCGTATGGAACATGGTCTTCATG
TCGTCATTCTCCTTGCGCAAACGCGCGTTGTCATCGTAGATCCGACCAATCATGCCATCGGCGTCGGCCATGACCAGCTGCGCACTCGACTTGCTCCGGT
TCCGGTTGAGAACTGCGGTGGACGGCGCAGGGACGACAACCTCTTGATCTTTCGTCTGCTCGACTTGGAGACGCACGCGCAACGAGCGGAGCTGCGTCGA
CATGTTGACTTGATCGCGGTGTTCGGCGAGCTTGGTCTGGAAGTTCTTGCGCTCCAAGTGCATGCGCATCGCCGCTTGAATCGTAGTCGCCGCGCGCTTG
AGCCGCAAAAAGCGTTGCCTACGCGAACCGTGAGTGCGCGCACGTGACAACCACGGGCGTACCGGACAGCAAACCCACGGACGTGGCTGAGCACAATGAG
CGCCTTGTGGCGGCGCTGCATGACGGCAAAGATGCGCCGCGCCTTGACGCCGCGCCAGCGCGCCTGAAGCGCCAGCATACCGTTGTAGAGTGCATGGTAC
CGCTTCATCGCAAGAACACAGCGCACGACCGCCTAGACGCGTGTCTGAATGCGCGCGCTTCAAGTGCAATCGAGTCGCACCTGGAGCTTGACGATCGCCA
TGCGCTTGCGCTTGTAGTGCAGTCGCGCGAGGAACCCGCGCGCAAAGCGCTGAATCGCAAGTGCGTGCACCGTCAAGCGCGAGCGCTTGATTTGATCCAG
TGCTTCGAGCACGCCCGACTGAAAGTAGACTTTGGTACGCCCGAGCTGGTAATGTGCCGGCGTCTCGAGGTGGAGCGGTGCAATGAGCTAACTTGATACA
TCGATACTCTGCCACTGTAAAATTGAAACATACCGCGGCGCACTGCTCGGCGGGGCGCGCGGCCGCAAATTTCCGGTCCAATAAGACGCGGTAGAGGTCG
AGAAACGCTTCGTGCGTGTGTCGAATCGGGTACGCGGCGCGGGCGATCCGGATCGCCTCAATGACGCCGGCGCACCGCAGCTGCGCCACCACCATGGTAT
GGTCCAGCACGCCGGGCTGCTTGAGCGCGTTGGGCTTGATGCAGCGAATGTACTGGACATTGGTCGCTTGAATGTTGGCCATGAGGTCGGCGAGGCTCGC
CTTGAACTGCATGCCCACCGTCGTTGTGTTGAGCGACCGGCCTTGGCGGGGCGCCGCCGGCTTGCCAAAGAGCTCCGACACGAACGGAATCGACGACGAC
CGCACGAGGTCTGCGAGGTCGGGCAAGAGCGCGTCCTTGTGCTTCTCGAGGAACCCAGTCACCGTGTACGTCACGGGTGCCGCATAGTGGAGGATCGTAA
ACTGCGCCTTGTTGGTCTTTGGAAACTCAATGACCGGGTTTGCGTCATCCTTGTGGAGCGTCATGGCCTTGGCGACAAACGACTCTTCATTGCCCTAATC
ATGGCGGTGAGTGGCCAATGAATACGATTTTTCCATCATTTTTTCCAAATTTTTCGAAATTTTGGACAATTTTTTGAGATTTGGAGATGTGACGTACCCG
TGGCCGCATGACTTCATCGTCGAGAAGCGAGATGAGCCCGAGCTTGGACTCGATGACCGCGAGGACGTCGGCGTTGTCGAGGAACGCGATGTGCGCCCAC
CGAATGCCCTCGTCTTCGTACTCGATCTGCACCGTCTTGAAGACGTCTTGCGTGAACTTTTGCTGCAGCTTTTCGTTGGCGTAGTTGATACAAAACTGCT
CAAACGAGTTGGTCGTAAAGTGCTCGAAACCAAAGATGTCGAGGACGCCAATGTGATGCGCCATTTTGGCGTCGTGGCCCAGTGACGCGTTGATCGTTGC
CACAAGCCATTCAAAGAGACTCGCGTACAGTCCTTTTGCAAGTGCATCGCGGCAGCCTTCGGCTTCAGCCTAAACAAAGATATGTTTTAGTATCAATGGG
TCCAGTTTTCCAATATTTCGACATTTCCGACATTTTCGAAATTTTGACAATTTTGAAAATACCATCAAATACAAACATGGACAAGGTACCTGTTTCAAAT
ACACTTGGATCGTGTCGGTCGACGTTCGCACGGTTCGCGAGCAGATGGCCCGCGTGATCGCCGTCGTCTCGACGCCGAGGAGCTTCCCGATCGCGACAAG
GTGGCCAGTCGAGCCATGGCTGATGGTCGACATGTCATCGCCCTTGGCCTCAAGCTGGAGTTGCCCGAGGTGCAAAATGCCAGCAAGCGTTTGAAAGAGC
GTCGTTTGCGCGGCCGGCGAGAGCCCGAGCCGTGACAGCGCCTGCGTCGTCTTGGCGAAATGCGCGGCGTCCGAGACCCCTTCGATGGCCGTCGCGGTCG
TCGCCCCCGTGTACGCATACGTCGTGCTCGGGTCCAGAAGGCACTCGGGCACATTGGCCGCGAGGAGCTAGTACATGCATCTTCGCGCAAGTCGAGTTGG
ATCACTATGTACCTGGTAAAAGATGTGGTAGTTGCGCTCGGGCGGCTCGTGCGACACGACGCGCGTCTTCTCGAGGAGGTACGTGTTGCACTTGGCGCCG
ACCAAAGTGCCATTTGCATCAAACTGCAGCTGCGTAAACTTGCCAAAGCGCGACGAGTTGTCGTTGCGGATGGTCTTGGCATTCCCAAACGACTCGAGCA
GCGGCGAGACATGGATGATCTTCTCGATCGTCGAGTCGTGGAGGCCGCCGGCAATGGCCGCGAGGTGGTGCATGAGGATCTTGGTCGTCTCGGTCTTGCC
CGCGCCCGACTCGCCGCTGACGAGGATGCTCTGGTTGCGCCCACTGGTGCGCATGCCATTGTACGCGCCGATCGAAGTCGCGTACACGTGGGGCGGCAGC
GACGCCTTGGGCTCGTTCAAGTACGTGCGGTGCATCTCGTCCGTGTAGAGCGACGGTAGCCACTGGTATGGGTTGAGCGCAATGCACATGTCGCCCGTGT
ACGTGTACGGCAGCTCGGAAAGGAAGCGCGCCTTGACGTTGTACAAGATGGCGGCTTCGTGGAGGTAGCTGAGCGTGATCATGTCGTCGACACCGACCGC
TTCGTTCTGCATGGGCAGCGCCGACGATGCGCCGACGTTGTTCTTGGCGGCAATGAGCGCCAGCGTCTTCTTGTCGCGCAGGTCGATGTCGCGGACGCTT
AGCGCGCCGTCGAGGCCGCGGACCTTGGCGCGGACCGTGTGCGCGACCGGGTCGTGGGCGACGACGTCGGCCGGCAGCCACACGTGAGTCTCGTCCGGCA
CGTACACGCGCGTCCCGGCGACCATCTCGAGGCCCATGCTGCTGCGTCCTCTTGGTGTC