Description :
From Genome Similarity Track
Location :
Scaffold_22:31303- 35294
Transcript NameFunction/comments
Albla_Nc14026070

Sequence
3991 bases(100 bases per row)
AGAATGCTCTTGTTGTTCCAGGTCAAATCAGACGGTGAGCTGCCCTTGGTAGGAAGCACCAAGGGATCCGGCCACCTCCTTCGGCTGGAGGATGGATGCT
TCTTCAAGAAGGAAGGCTGTCAATATGTGTAGCACTGTCAAGTCGTCGACCAGCTGAGTAGCACAGTGCGCATCAACCCATTCACTGAGAATCAAGTTGC
CGAGAGGAGAGCACAAAAGCTGTATCAACACATTGGTTGGAAGCAGCCGACAGTAATGTGCTGGGATCCAAATCACTGGTTGACCAGTGAGATACTGAAC
CCAGTGGTTGCTGGTGAAGAGCTTAGGTGCAGTGCACATCAGCACTACTCAAAAAATGCGGGAGATCGGGTTGCGCGTTGCAAGTCGTCCATAGCTGGGG
AATCGCTCCACCAGTGGGATACTGAAGCGAATTAAAATTGTGGCTTGGTTGGAACTTTTCCACCAATTCGCTTTGACCATTTTAAAGGATGTGTCAGAAG
AAGGCTCGAACGCCGCAAGAACACGATTGATCACGTAGACTTCCACTGCGTCTGCCAGATGAGCAGCATTGCTCCGAATGCTGCTGTGGAGCACTCCATG
CAGAGCAACCGGATGCATGGAGGCAAATTTGACAAGAGTATCCCCGTTGCAGGTAGACCTGGCAAATCTCTCCGCTTTTGAAACCTGAATGTCCAATCGG
AGGAATTTGTCCATCGCGATCGGAAGTGTGGCCGTTCGGATATCGTCGAGAAAGAAGTCTACCACTTCGCCAACGCGAGTAGGCCGCTCATCCTTTGCGA
TACGCGTGTGGTTTTTCTTGAGAAAATGATAGGCTTCATTCGTTTCAGCCACAGAGGTAGGTGTCCCGACCCTGGATGGCACGACGTGGTATCGCATTCC
AAAAGCCTTCCGTGTCGAGAGGTCAATTTTTTTATACTACACGTCGATTGATTGGAGTACTTCGAAGTAATTCCTGGTTTGAAGGCCCTTCTACTGTCGG
AGTGGGGCCTTACTAACCAAGCTTTTGAAATTGTCAATTGAGCGATTCCGTTTATTACCAGGGCGAACGAACGTCCCAGATAAACTCTCTTTGAATGGAG
CGACTTTTCCGTAAGTAGGTCCTTCTGGTTGCGTAGCCGGATGAATATTCTTGTCCTCCGTAGATTTTGAGGATGAATCCGGTGGAGACCGCGGAGAGTG
CCCATTGTCTTCGAGAATGCTCTCAGATGTACCCGAATCTGAGGGTGTTTTAGTCGCTGGGCGTTTTTCACTGCCTAAGGACCTCGGGAAAGGCACGTTG
GCTGTGTGTTTGGTATGGAGTTTCGCCAATGGGACTTTACTTGTCGATGTACCAGGTGATGTAGGAGGCGGCTGTTGCGGTTTGGGAGTTTTCGCTGGCA
GCGGTAAGCAGTACGGATTGCGCTGACCCGTCCTTAGCCACTCAGCCGGAAGTGGAGTTCCTTTTCCACGAGCCAGATAGTAGCGTCCAGCAATACATGG
CCGCTCACAGATCTTTCCTGATACGAGAAGGGGTGCCGGGAAGGCGGTGGCGTGGAAATACACCCGATAGGTGGACATTGCTAGTCGTTGGGAAGCCACT
GTTACGCGAAAAATCTCATATAGAATATCGCATCCAAGACTATGCAACGCAAAGATAATTGTCGATGTCGGTATTTCCGGTTCAAGGCCGAAAATGTCTA
GAAAATAGCGCGATCCGAGAATATCAAAATCCCGGACGGAGTACTGGTTACCAAGAAGGGTAACTGTTTCGTTAACCAACAGCTGGCAGACGGCCTCCGT
TGTAACTAGAATACGGAGGTTGCTACCGGGCACTTTGCTCACATGGCCAATTTTTCTGGCGTCTAAAAACTCGCCTACGAGCTTACTGCCGTGATCGCGA
GCGAACGATTGGAAGATATGAGCTGGAGACGTGCGGACGAACGCCTAACCCGTCTCCAATATAACAGAAAATTGCGCAGCTGGGATCGTAAACGGTTTTG
CTGCCGTCAAGGGAGCAGACAATACGTACCAACTCAGACGACCCTCCTCGAAAAGCTAGTCGCTATTAAATCCGAAGCGATAGGCTTGGGCATTTCAACC
TTCCATTTACCTTTTCGAGCAGCCTTATCCGTGCGGATCTCATCGTGGCCCTTGAGGATATCCACCAAGTTGGGGCGGTTAGCCGTCGTTACCGGTTCGT
GGAAAGTGGGAGGAGACGAGAATGACGCGTTCGTGTCATCAATTTCTATCGGCACTGGTGAAGCAGCAGGAGTGTGACTCTGGGTAGGGTTAGCGTCCAT
ACATACCTCCCAAGAGGTTATAGGGGGTTCCGGCGAATCGGCTTGGTTGGGCTCCGGAAGCGACGTGACTACGGCAGGTGGGAACGATGCATTTGTTGTG
ACATCGGCCGACAAAGTGACGCCGGAGAAGCTGGTAATGTAGATAGAAACCATTGGTTGCGACAGGAAAATTGAAAACCCGTGGTGTTAATTTTGCTAGG
TTTGTTGAGTATTATTCTGTTTGCGAGGTGCGGAGTAGCCGGCAAGTTGAGAAGTTATTTGCTAAGCTCAGTGGTGCAGCACCACATAAAATTCTCTTTC
GCTAGCTCCTTTCGGTAAGACTTTTGCACAGTGATGTCGAAGGGAAAAGTTATGATGAGCTCATGGTTGCATATTTCTCCATCCTTTGAAAATACATCGG
AAATCTGACAGAGGAACGGCAATGAAGAGATGAAAATCATTGCTTTGGAATCCATACTCGAAGTTTCAAGTTGACCAAAGCACTTTGGTGATATAGCAGC
GCAGTGAGCTAGCTTGAAGTGACATAATCGCCTTCAAAGGGAGGTATCAAATTTACTGTGTGTGAGTGACTTGAATTGACTCAACCACCGACGCTATTGT
TGTAGGACTACATAGAAAACCAAAAAAACCGTGGCTTTGACCCACAGAATCTCGAATTTCTGATGTGGTCTAAGCCTAGCACTTCCGTGGCAGGACACTG
CACGGGAAGTGATCCTTCGGAAAATTGTTCTCACAATCTTATGGAACCCAGCTGCAGTTACCATTTGGCATCATCACCAGCCATGTGACGAGTCGAAGTT
TTTTTGAGTAAAACATTTGAGAAAAACGCAAGATTTGCAGGATTACGCCAGGTACGCAAATGAAGGACATTCTATTTAGCAAAGTTTTGGAGTGCCGACT
CAACCCAGATAGTCGTCAGTGGGAAGTATTGGTGAAGTGGATTGGTTTAGAGGACGCCGAGAACAGTTGGGAGCCATTGAGTATCACGCTCGATAAACGA
GGCAGCCTCAGTATTTGCCCCCGTTACTGGTACGAATTCGCAAAATCCATTCATACCGTCATTTAAAACCAGAACGTAGAAGAAACCATTTGATACACAT
AACTCGCCATAGTGAAGTATTTCGGCGACACGTTCATTTCTGTCATTAATGGTTGCCATTCCATGTAATTTCTTTGACACCAATTGCAGAAAATTACTGT
GTTCCTCCTCTTCGGCTCGTACACATCCATATCCAGTCTTCCCCTACTTTTATCCTAAAAGCTGTTGGCTCCAACGATTCGACCATCCATTTCATTACTT
GCTTCGGATCCGAGTGCTCCACATACTCTCGGACCCCGTGTCGATCCAATATCGATAACTTTGATTTTTGAGTCGTAACATTCTGGATCCTGCATCCATT
AGTGTGGTGTCCATCCTCAATTTTCGCACTTCTTTATCATCTTCGACAAATTCCCACTATCAGGTTTTCTGATCCTCGAAAGTAATTTATCCAATCTTGT
TCGGTCACTTCCATCGGGTGTTTACCCATTTCGAACTTCATAATTTGCTTTTTTGTCCACACATCCACGCACGCTGATACAGGCATTACGAAGGGCTTAT
TGAGGCATGTTTCGTATGCCAATAGCATGTTGTAATAGTCCTGATATGTTTTGACGAGCTCCGGTTTTTCCTGAGACGTCTCTCCCCGGTA