Description :
From Genome Similarity Track
Location :
Scaffold_1:313003- 328416
Transcript NameFunction/comments
g99.t1hypothetical protein
g100.t1XP_009515493.1 hypothetical protein PHYSODRAFT_343759 [Phytophthora sojae
g101.t1XP_008909677.1 hypothetical protein PPTG_14842 [Phytophthora parasitica INRA-310
g102.t1hypothetical protein
g103.t1hypothetical protein
g104.t1OWZ24706.1 Ferric reductase/NADPH oxidase [Phytophthora megakarya

Sequence
15413 bases(100 bases per row)
TCAATGCTCTACTGTTGCACGTCAGCGTCTCCATTCGCATTATCTCTGCGCCTCTTGGACTCCGCACCAACCCGTTTGAACTTCTTGCTCTCCGTCTTGT
TCTGACCGCGATACTTTTGCTTATCCCAGCGCGACATCTGCAACGAATCTCGGCACCCAGCGCCACCTTCCCAGTGACGAGAGGTTGATTTCTTTGACGC
AACGTCGTTGCCGCAGGAGCACACTTTAACCGAGCTCGACTGTTCCTTCGAGCAGAGGCCACAAATCATCCTACTGGCAAATTTTCCAAGGTTGGCTTCG
GGGCAGTCGCTCGAATCGTGGCAGACATCACACGGAAACGTTTTGCCGCAGCACTGGAAGCGAAACCAGCGCAGGGAATGCTTGTAGTGATCACAGACTC
CATTGCGAGGCAGGGGCTGTCCCAGAACAAACGTTTCCACGACCTGCTTGCCTCCCTTCTTGTTGCTCTTGGTAGTCTTTGTTGCAGTGCCATCAGGAGA
AACACCCCGTTTACCGCTTGATCCCTCCAGCTGCCCAGCCACGAAGCGCTTTGCCATCACAGCAAGCTTGACATGGCAAGCAAAGCAAGCTTGCTCTGAT
CGCTGTCTCGGTGTAATTCTTTCCAGTAAAGCTTCACATCCGCACGCCAGGCAAGTAGCTAGCACGTCGGTGGGTAGCACGTCAACAATTGAACAGTTTT
GAGTGTCCACATAGGCCAGCACGTTACTCTGTGAGTGAGCAAACACAGGTCTCATAAGCACGTGGTGAAGCACGCTACACCTGGGGCACCACTTCTGGAT
CTCTGTCGAGTCCAAGGTCAAGATGGCATCGAACTTGAGTGGGCAGTTATCGCATTGAACCTGGCAAACAAGTCGATGAGCGACAAGCGTGCCGACTTCG
TGCAGAAACAGATGCTCGAGAGCAATCTGGGTGCCCTTCGCTTCAGGTTCAGTTTCGATGGCGACACGCTTCTCTGGAGGAGTGATTTTGACGTTTTGGC
CGTTGTCTTCAGGTGCCTCCACTTCTTCCTCCTCCATAGCTTTCTCGGTAGCTGCGGCAACGGTGGGGTCCACGCCGCGGCGCACGAGTTCACATAACTT
CTTGAAGCGGTCGATGCACTCGTTCAAGGTCCGACCCTCAACCTCACTTGCTATACTGGTCCATCGTTCTTTCTTGTCCATCGATGGCGGATACTTCTTC
AATGCCAGATCAAGCGCACGCTGTTGCTCCTCTGACCACTTGCTGCTGTTTTCGTTGTGTTGATGATGCCCATCCTTAGGTTCGTCTGTAGTGCTGTTCA
CGATTGTGTCCGAGTTGTTGCTGTCTTCTGCTGTCATCGTGGACCTGATCGGAGAGCCCATTTGAACTACAACGGCTCGTGTCGGAATGCCAGCGTCATG
CCTTTGGCCCTTGCTGGCTGCCCCTGCACTTTTGAGCTCATGAGAGAATTTGCACTTATCTCCATCGCGGCACTTGTTCTGCTCGAAAAACTTGCACTTC
CGCACACGACTTTTCTTTTTCTTCTTTGGTTCTGGTACTGGCGCAGTTGCTGATGCCTTGGATGTTTGCGTTAGGTCAGCTTCCCTAACAACTGAGGTAG
CACCCTCATCGAGCGTTTCAAACACTTCTTCACCACTGCCTTCCATCACTTTTTCCTGCTTCTTCACGTGCAAAAAGTTGCAGTTCTCGCCATCCTTGCA
GTTACCTCTGGCAAAAAAGCGGCAGGGTCGTCGCCCGCGTCTTCGCTTCGGCTTCTTCCCAATCCTACAAGACACCTCTTCTGCCACAGACATCGTCAGT
TCTTCATCCTGAACACCGTTATCTGATGCCTGGCCACTGCCATCTGTGGTCGCGTCTTGCTCCTTTTCCACCTCTTTCTCGAATGACTTAATAATGCGCC
AAAAGCTATTGTCGATCCAGGTGAGCAGCTTCCTCAGCGAGTAACCTCCACACAACTGCTGAGCTCGAGCGTTTACCGCAGCATTCAAAGCGTCAACCTG
CTCGTCCGATAGTCGGCTACTCCATTGCGTAAAATCCACGTGAACAGCTTCCACCGGATACTTCCCAGGCAGCGTCAGTTGCAGTTCCACTTGGCCTTTC
AGTCGCGTAGGCAGCTCCGGATCCGACAGACTCAAGAACAGCCGCACGCGCATGTCCTGCGTCGTGGCATCCTCGCTCACCAGCTCCACGTAGTAGCGGC
GCTCTAGCGCCATCCACTCCTTCTTGGCGGCGTCCGTCTCGCTCGCCAGCTTCTGCTGCCAGCTCAGTTCTGCCATCGTCAACTTCGGCTCCAGAAGGAA
AGTTCGATTGTGAGCGTCTATCAATTAGTCTGCACGTGATTGGTGGGTCGTTTAGATCAGAAGCTAGAGACTTGACCAGTGCGCGTGTTCCTAGAAAGTT
CCTTCAGGCGCCGAGCCAAGTCAAAAGGTTCCCAACGGCGGCGATGCCCATGTGGAGCGTTCGTCTGCGCGGGCCGCGCGGCAAGCAGGTGGTGCTGCAG
ATTGACCCAGACACCGACTTCAAGACGTTCTCACGTACGTAGCGATGCTGGGCTTGACGTTGGGCGGGTACCTGACAAGATTGTGTTTTTTTTTGTTATG
AAGAACTGGCGGCCAAGCAATTAGGTCTGAAAGCCAAGGATACACCGACGTGTACGTTATAGGCGATGCATTGAGTTGGTTACAACAACTAGGGACTGAC
ATGCAGTGAATTATTGCTACACGGGTATCAGTTCGCAGAGGATTTCCGCCTCGAGCGGTTGAAGTGGACGGCTCTGCACTTATTAAGACCGTCTTTGAAC
CCAACGACACAGTGGTGATGGACACGAACGCTGGATCTGCAGCTTCACTGCAAGTTGCTGCGTCTAGTACAAAAGCGAAGGCTTCGGCGAGACCGAAACG
AGCAGCTGCAAAGAAAGCAGCAGCGAAAGCACCAAGAGGCGGGGTGCACACGCTACACCCACCGACCAGCGCGAAGAAGAAGGTCGCACCGAAGCGGAAA
ATCCCAGGCAGCGGACACCAGCTTGGAAGCTCGCTGGAGAACAATCCAATTGATGCAGCGACTGCGGGGGCTGACGATGATGAACAGGAGCCACAGCACA
AATATCGCCGTAGCCGTGCGATCAACCTCACGTCGAAAGAGGACGTGGAGGTCAGTCTGGTGAACGCCGTGAGCGGCCAATCTCACGACCGTGCATCAAA
GTTTTTTCGTGCGGCGACCAAAAACGCGGTGGAGCATCAATACGAGCTGACGTTGGCCACCGCTAGACTGAATGCATCGTTGGCCCGCAATTTTGAAATC
GAGGAGCTATCAACTACCCGGCGTGGTGACGGTAGCGCTGCTAAACTGCGCATTCGTTTTAAGGAAACTCCCCGCAAGTGGAAAGAGGAAACAGTGGATT
TGGTGAAGACAGACGAGCTGCAGGCCATTTTGAAATACGTGTTGCTGTCGGGCGGTGAGACTGGGCGCGAGATGCTAAAGCCGTTTAACATGGCCCAGGT
GTCCACCAGGGTCTTTTGGAACATTGCACGTTTGTATGATGGAGATGTGGCTGCTGGTCTGGCAGACCTCGTGCCTGACGAAGATTGGTCATTCTTGGAC
ACTCGCACTCGGTAAGCTCGGCAAAATGTTGTTTGCAACGTGGACCATCTTGCTAACATAATATTGCGTGCTGCTTGCTTAATACAGAGTGCTGTCTGAG
AAAGCGATGGAGGCACAGGTACAATGCACTGCATTTTAGGCTGCATGCTACGCTACCGAATAAGCCAGTTTTGTAACAATTCATGTTGCTACACTTGACA
GGAAAATGAAGAACAGTACAAGTTGTGGAAGCAGGGTAAAGTCCAGGGTGGTGAAGTGTCGTCCCCGAAGACAGAAAGTAAGCCACCGGCGAAAGAAAGC
AGACGAACTGCGGCCACGGAAAAGAAAACCGACGTTATTAACGTGGGCATGAGTGATGAAGAAGAGGTCAAACAAGAGGCTGCGGAGCCTAAGCGAGCTG
CCCAGATACTTGCTCTTTCAGCTAAAGAGGCGACTCCTACTACTCTACGTAGTGCAGCGGCGCGGGCGGCTCTAGCCCGGTTCGATCGCACTGCTCAATC
AAGTGCCGTTGTATCCGCGTTTCTTAAGGAGGAGACGCCGACTGCCCAAACAACTGAGAAGCATGCTGCAAGCGACGACGAGGAAACAGAGTCTGAGGAG
GAGGTGGAGGAAGCCACTACAGTTTATTGCGATTCTTGCAAGAAAGCGCGTATCCTTTCACCTGAAGAAGCCACCAACGCTGAGCTCGATAAGGATCCGT
GGACTTGCGCCAACTTAGCCAAGACTGGACGCAGCGGGTGCGATGCCATCGACGACGAATTAGCGCAGATTGCGGGAACTTCTATTGCAGAATGGCTGCA
AAAGGCTGGTATTACCACTCGTCGACAGCTTGCGGACGCGTGTGTGGGCTCCACCTTGCATTCTCTAGTGGATCCGATGGACCCTTCGGCTCAGACATTG
CAGGAAAAACTTGAAAAGCTGATCGACGAGGTTAGTGAAACTATGATGAAGTGTGTTGCTGACAGCGTACTAACGTTTGACTACTCGTGATTTGTGAATG
AGTTAGGCTCGCCTTGACGAGGTGAATGACTGGATGTCGGAAATTGTCGGTGAGGTCGAAGTAGTTCAACGGCTGGAAGTCCAGAAGCTCGGTACGCCTG
CCGACCTGTTAGCCACGCCAAGCGACTTGATCTTGGAGGCTCTCGGCACTGCTCCTGGCCGATCTCTGGAATCAGTAAACTCCTGGCGAAGACGCGCGCA
GAGTTTGGTCGACGAGTACCCGTGGCTGGCAGACTGGTGCACGCTGTAGGCACGCGGGTCGGTGAATTGATTCTGTTGATAGCGGGGCGCTCGGATGTTG
TTTTGATGGCCACAGCTTTTGAAACGAAATGAATTTATTTTTCTTTCGCTTTCTGGTTTTCTGTCTTCTACACACAGCACGAGGTGTCAAACGACACATG
CATGGCTTGGATATGACGCTAGGCAACCCGCTCCACGCGGTTGTGTCACATATCTACCAGCCAGGGACCTCCGTTCGTTGCTGCTTCGCTATCCGCCACC
TCTCGCTATTTCTCTGCATCGCACAGTGCTGTGCTATCTGGGAAATGCTAACTTGATGCCGACTTAGTCGATCTTAATGGAGCTGTAGATCTTGCGCGTG
AACCAGAGGCAAGCAAAGTAGCCGATGGTTCCCGTGAGGAAGAAGAACGTGATCGAGATCAGGAACATATAACCGAAGTACAGAATGCCCGAGACGAACG
CCGTGATGTTCAGCTTCGTGAAGAAGTACAGGAACGAGTAGAGGAACAGGTACACAGCCGCCGAGCCCGAGGTGAGGAACGAACGCCACCACCAACGGTA
GTCCTCTGCGCAGAGCTGGAAGTAGCACATCACGACCGTCACCTCGGCGCACGTGGCCACCAGAATAAGCAGCACGATGAACAGGAAGCCGAACACGTAG
TAAATCTGGTGCAACCACAGTGCCGACATGATGAAGAACAGCTCAATGAACACAGCACCGAACGGCAGGATACCGCCCACGAGGATGCTGAATGGTGAAG
ACAGGTACCACACTTGCTCCGGAATCTGACGCGCAATCTGGTTCGTGCGCACAGGCTGCTCAATGGCCGCAGCCTTGAAGCCGAAGTAGCTGCCAAGGAA
CACGAGCGGCACCGAAATACCGAACCACAGGACAAGCAGCGCAAAAAGCGTACCGAACGGCACAGCCTGAGATGAGGCTTTGCCCCACAGCACCAAATTC
AGCAAGAAGAACACAGCAAACAGCAGACCCGGGTACAGCACGGCCGTGAGGATGGTGTTCTTCTTCCAGTCTTTGCCGTTGAACATCTTGTACGTACGCG
AGGAGTGGTAGCCGGCAAAGCTGCCCATGAACACGAACAGCAGCAGCAGGGTCGTAAGCAGCGATCCGCGGTTGGCCGGCGACAGCAGGCCCAGCAGAGC
GATAAGCATCGTCGAGGCGCTCATGGAGCACACCTGAACACCCGTGCCAACAACCACCGAGAAAAGCATGGGCGAAAGCTGCGGCGGGCGGAACACATCG
CCGTGGACAAGCTTCCATCCGGACTCCTCCTGTGCCTCCTCCGTGGTCTGCACTTCGTTGTAGCGCGCGATATCACGGTGCAGCGTGCGCAGCATAATCA
TAGCGATCATTCCCGTGAGGAAGAGCACGATCATGAGCGAGTTAATAATGGAGAACCAGTGGATCTGGTCGTTCGAGCTCTTGCTGCTGATAATGCGGTC
CCAACGTTCCTCCCAGACGATGTCCGACTTGACAAACTGCACGTCGTACGTGTACAGCACTGTGGTCTCGCCCTCCGGGTTCAGATACTGGTAGTTGCCC
TGCGACACCTCCTCAATGTTGACGAACTTGCCGCATGTGTCCGAATCGAGCTCCTGTCCGGCCATGGGCTCGTTCTCGTAGCTGTGCTTGATGGACGTGG
GCACGACTTCGAAGCCGACGACGCGCCACTTGGGGACGTCGCCATCCTCCTCAGCGTACGGGTCCGAGTTGACCGAGACGATGATGCGCACATGGTTGTA
CAGCAAGTATTTGCCGTCCTCGTCCACCTCACCCACGGGGAAACCGCGCTTAAAGGATCCAGCCTGCTGCGAGTCCGTCGGGTCGCGGTATAGCACAGGC
AGGTTGTCCACCACCCACTGCACGTAGTACTCGTCCTTGATCATGTCGATGAAGGACTGCGACTGCTCGGACGTGTACGTCATTGGCTTGCACAGCACCT
GGCAGATCGCATCCTTCTCCATCTGCATGTTGTAGAGCGAGTCCATGATGGCGTCGCCGGCCATGATCTCGCCCAGGTTCTCCTGCTGCTCATTTGTGGC
CGTGGGCTTGCAGAATGGCAGGTAGTAGTACTCGTACGGCACCAGCGTCTTGGTGGACGTGATCTTGTTCACATTGAGACGCACAGCGTCGCCCGCAGCC
CAGGCCTCGGGCGCCACGCCAGGCACGTAAAAGGCCGCACTGGCCTCCTGCACCGCTAGGAGCGCAGCCAGTGCCACGCTCTTCATCCACATTGTAGCTC
GGAGGGAGGGAGGGAAGGAAGGAAGGAACTTAACTGCCGCCTGACGTCTGGCTTCTTCGAGGTTGGGGAGTGTGAGGAGTTGAGCTGCCACGAAGCCGAC
GCCAGAAACAATACCTGCGCAAAGTGATAGGGAACACTTGGAAAATGACCTGCGGAAAAGAATACGACAGTGGGAGAGGCAATCGCAGACACGACATTGG
ACAAAAGTGGCCCACCGCGAATCAGATCACGACACGACGTAGTGTGCACCACACGAAACTTTATTCTAATGTACCACACACGGTTTTGAAACCTCTCATT
TCTGTTCTGTGTCGGAACCCCTCGCGACGGCAAAAGCGGAAAACTGCAGCGCGCTCCAGTTGAAGCTGCCACGGCGCACTCAAGGTCACTCCAGAGAGGC
AAGACCGAGCACTTGCGCAAAAGCAGACCTGATCCTGCGTCGATCCAGCCCCGCTTTCTGCCACAATTAGATTAGCCATAGGCCCCAATTGGATCTGGTG
TTCGTGGTCTATTGTTGTCCGTCGACACTAAGTAGGTGCTGGCCCCACATTAGCCGACAGTTGCGAAAGCAAGAACCAACCACCAGAGGAACGAGACGTC
CGTGACGCAGCTAGTCGAAGCTATTGGGAGCTATGGAGATCGCCGTGGTCTCAGAAGCTGTGGTATCCGAGGCGCTACACCAGCTCTACAGCCCATTGAG
CTCGCCGCGCGTGCGACGACGCGCAGATTCGCTGCTGCAGCAGTTCCAGCGCTCGCCAGAAGCTGCACAAACGGCGTTGGCCGTTCTACAGGCGCAAATC
GTTGACACGGGGAACGCTGAGCACAATGCGCTGTTGCGAGCCAAGCGCGCGTTTTCAGCGTCGACGGTCTACTTTACTGTGGCCTCGTACATCCGCAAGT
ACAAGATGGACGACCCAACCAATTGGACGCCTGAGGATCGCGCTCACCACGAGGCGCTTGTGAAGGACTTTGGTCAGATGGCGCAAGACGTCTGGAACGT
GTTGACTGGGCCCAATGGCACACAGGAGGAGCTGAACGTGCAGACCCACCTGGCACTTACTATAGCAGTCATCCTGCTTCGCTTTCATGAACCCCAGGGT
GACACTACCGTGGTCGGCGCTGTGGAATGGCTCGTTCAAAACCAGCAGCAACCGGTTAGCGACAGCGCGACAGCAACATTAACCAATTTTGCTGTGCTGC
TAACGTTGAAGGTTATTCCGGAGGAAGTGGAAAATAAGCGCGTCAAATTCTCCAAGGTCAAGCGTGTTCGGTGTGAGGATATGGTGCATCAGTGTGCGGC
GCATGTCGTTCGGACAGTTCTACCGTCGATTGCCACTGCCATTGACGCAAGCGAAGAACAGGTACCGTTGCGTAGTCTGTTGTTGCAAGCATTTGCGAGC
TGGGTGGAGCACGGCACAGTATCCCCGCCAGTTATTATCGAGTGCGGGCTACTAGATCGTGCTTTTCGTGAAACATTGGTCCCCGCGTCTTCGGTGTTCG
CGCTGCAGGTTGTACGCGAAGTGGTGCGTATCTGCCGTCACGAGGAGCATGTGCAGCTGATGGAGCTTGTAATGCATAATTTCGTGGTGCTCGGAAAGCA
CCTCCAAGAGCGTTTAGCAACCTCTGAAGAAAGCGCAGACTTTTGCCTTGCTGACTGCGCTAGAGCGATATCCGAATGCGGGCAAGCTTTTGTCGTGTAT
TTTGTGGACTTCACGTTGGATATGCGACCGGGATCCCTAGTGTACGAGTTCTTGGATACAATCTTGTTCTTCACGGCGCTAAACAACTTGGACATTTCTA
ACGAAACGATGGAATTCTGGATTGACTTTCGCACATACATTTCTGGCAAGCACGAGCAGCGCATGTACGTGTTTGAGACATTCATCTCGCGAATACTGAT
CATCTTGATAGAGCGCACCCAGTATCCCGAGGGGTTTGAAGCCTATCCGGAAGCAACCAAGGAGCGTTTTTTCCTGTACCGAAGTGAAGTTCGCAATGTT
TTCCGCGCACTTGCTACTGTCACGATTGCTAGCGAGGACAAGTTTATTGTCGATGCCATCCATGCGATCTTTCAGCAGTACGAAGCCGCCGATTCGGGAG
CTCCCCTGCCACCGAATGTACGTCTACCATCACGATCACGTGCTGCTGATTTAATACGTTTGCTTGGTAAGGTGAACTGACTCTGTTATAACTTGGGTCT
TCGTTTTGTGTGTGTGCAGTGGTGGCAACGCACAGAAGTGTATGTGCACGCTCTGAGTGCGTTGTCAAAATCGATTCGCGAAGAAGACACATCACTCGTT
CCTAGGCTTTTTGAATGCTTGTCGCGGAAGGAGCCCTCTCACCGCGCACTCTCACGCACGATAATTATCTTCCTTGGTATGACCGGCCATTGGTTCGCAA
GACACCCTGAATTCCTGTCAACGTGCGCTTTCAAGATAGTGTCCAACGGCTTCGAGCTCACCCAGGATGATCCCGGATTTCCGTTCAGTCAGCACGGTCT
TGGAGATCATGTCGGTGCAGTGGCACTGCGCAAGTTGACGCTTCGTTGTGGCTCACACTTCTTCAACCCGCTTTGGATGGACGCATTGGTAAATCTGTAT
CGCTCGAATCGCGCGGCAGTAGGCAGTCCGTCAAGTCCATGCTTGTCAGGGGATAGTGCCAGGCTCATCGTGGATTCAATTTGCCATGTTCTCTCGACTG
TATCATACAAGGATGCCCTCCCAGTGGTGGAGGAACTCGGTATCATCATGTTTGCAGATCTTGCATCTCGTTTTAACCAACTAAGTGCGGATGATGAAAG
CTCGGTTGAGTTCCTGTGCGAGATGTTTAATCATCTTCACGTTTTAGCTACGAGGGTCCCTCTTCAGATGGACCAGGAGATTTCACACCCAGTGCTGTGT
GTGTTGCAAAAGCAGTGGGATATAGTGGAGACGATTTTGCGCGTGTACGGTTGCAGTGAGGAGGTGGTTGAGCAGTTCTCTGCGCTTCTAGTCGGAGTAT
TTGAATCGTTGCGGTCTCAAGCGTTGGAACTAGCATCTGCGATTATGCCAGCATTACTGGAGCAGTTCTCGCGTAGTTATGATGGCAGCTATCTAAGCGT
GATCAGAAGTATCATTGGTTGTGCTGGTGATGACGAGGCTTCAGCAGTTAGCTTAACGCGTGTGATGGTGATTGTCAGCGAGAGCTCAATAAGCAAGATC
GCGACAGACGGCAGCGTTGATGAACATCCAGGGCTTACCATTGCACTGTTTTCTCTTGTAACCACCTGCGGCACTCACCACCCGTCGATCTTAGTACAGT
CGAATCAGTTGGAGGCAGTGTTGGCGCTAGCGCTACACGCTTTCAAGTCACAGAATCCCGATGTCGGAGCTGCAACTCTCGACTTCCTTTTGGAGTTAGG
CTCGCTTTATGGCCAGATCCTTCGCACCCCAGAGGCCTTGCTTCACGGCTCCGAGTTCGCAGGCAAGTTACTACTTCACCAGCAGATTCAGACACTGTTC
TTTGAGAAAGATGTGCAGTACCACCTGCTCTTCGCATTGTTTAACGCCGCGGCAGGAGGCATGTCACCGAACTTGATGGAGAAGATTGCGGAGGTCGTTC
GGTCTTGCTGGGTCTACTTTGGCCGGCAGCGCAGTGAAGAATTGATTCGTCGGCTTCTGTCCGACAGCAACTTTTTGGGCTCGCAAGTTAGCGAGCGAGC
GCGCACCGAATTCCTCAACTACATTTCCACACCGACATGTGTCGAAAACTCGCGCAAGTTTAGGCGCGTACTGAACACGTTCTGCGACCACTTCAAGCGC
AACCTTACCAACAGTGCGAACGGGGACGCGATTCCTTTGTAAGAAGAGATTCCAGTAATTTGCCTTCCGGCACGATTCGGAAAGTATACCAACTGGGCGA
ACTGAAAGCGTAAATCGAGAGATGGCCGGATAATTTTAAGGGATACTACTCTCGCCCTCCTTGCCCTTACATTGTTTGCCAACCCCATCTACTGAAACGA
GTTGCCAATGTCTTTCCACGACGTCGTGTTGTTCTCAGTGGTTGCAGTGACCAAATGCCCACTCGGTGGGCGAGCAGTGTAGGGAGAGTTCGACCATTCC
AAAATCTTCTCTGCAATGTCCTCTGCCTGCAATTCAAAAAATCATAAACGTGAACTCAATCACGTCCGCAAATCACCATCAGACATTCTGCTGTACCTTC
GTCCAAGTAGAAAAGTCTGCGTCGGCCATGAACTTACGGTTCATCGGTGTGTCGATTGTCGCCGGGAGAACGCCCAGCACAGACGAATTTTCAGGGAGCT
CACTCCTGAGTACATGCAAACAAAATACAAAAGTACCATTAGTCTGTGATCATCAGCAGAAGCTGTCGAGACGTACACTGCACTAGCCACCAAGTGATGC
GTGGCCGCCTTGCTAGCCCCATACGACACCATGCCCGGCGTAGCCTTCAGTGCAGCTGTTGCACCCGTCAGAACGAGCAGTCCTCCCGGTACCAGCAAGT
GGCTCGCCAAATACGTCGCTACCGAGTCAGCCAACCATAAAACTGTTAGCCGTCCACCAACTCTCACCACACTCGCTATCACCCACCCAGGAAAGCCGAC
TCGAGGTTCTTCGAGTGCATTTCTCCTAAATTCACTAGCGAGTCCGCATCACGGATGCTACCGCCGGACCAACCGCCGGCTGTGCACACCACAGTGTCTA
CCTGGCTGCATCTACTGGAGATTTCCTGCAGCGTCTGTAGCGCCTCTTTGAGCGAGTTGCTCTTGGGCAGAAGCACATTGTTGTGGGCGTCCTCGTTCGC
AGTGAAGCCCACGGACGTGATCCCCCACGATGCACGCGCGAAAAGGGACACCACGCCGCGGCCCAGCGCACCGGTGCCGCCAATGACAAGCAGCTTCTTG
GGCATCTCGATTTGCCTTTAGCGGCAAGTTGAGGTTTGCCGAAGAAAGCGCATTTTTGACCAATGGGATAGCAGCTGAAGTACTACTAATATATTATTGT
ATTGTATTATATAATATTATATGTATTTCTTGATATTACTACGCAGTACTATGTAGTATCTCAATGCCAACTTTTGACGGGCACTTTCCTGTTCAAGTTT
GTATTATCGGTACTGGTACGGTATCCTGACGCGAGGAAAGTTATGCAGCCAAAACTATTGCACTTCAACTTTACGATTATCAAAGACGCAGAACTGCCCT
CTACTCGGCAGCGAGCACACTATCGACGTATATCTGCTAAATCTATGCGAACTTCTCCGAGTGGAAGTCGAAGATGGTTCCGTTGGGGTCGGAGGACGAA
TACCGCTTACATGTGGTATCCAGAATCTCCTCCAGAGCGTGAGGGCCGCAGTAGAAAACACCGACCTCTTCTCCAGGGTGGTTGGCTTTAGCCTCGGAGA
AGACCTTGTCCCAGTCCGGACGACCGAAGTGTGTGAGCTGCTTAGTGTTGAGACCAGACACGAAATCCTTGCCAGTCTGCTCGTGCACGAACTCCTGGAA
CATCTTGAGTTGCGAGGTGTTCTCACTGCCCTTCAGCGTACTCAAGTATTGGTGCGTCTCGATCACGTTATCGCGATCCATTTCGGCGATCTGATTCATT
GTTTCTTCAAACCAGCTCAACGATTCCTGTCCACGGGTCACCCAGTGGAAATACAGCTTCTGGATCTTGAAGGAGCCCGGGTGACGAACATGGTTGCAGT
TCGAACAACGGTTGTCCTCCCACAGATGAACCACATCCTTCAGAATCGACGCGAACGGGGTAACACCGATGCCACCACCGACACAGATGACGGTCTTGTA
GCGGTGGTAGTCTTGTGTTGGAGCACCAACCGGACCATCTAGGTAGATGTCCGGGTACAGCACCTTGCGCTCGTGGCAGTCCGAAATGACACGGCCCATG
GCTTGAGTCCAGTCACCACAGACGCGCATGTGAATGCTGATGTAGTTGTCACCCGGAGCCGATGAAATCGTGAATGGGTGCCACTCGTGAGAAGAGATGA
GCGGACAATTAATGAACAAATACATGCCCGGTCGGTACACAAAACGACGAGGCTTCTCCATGAACAAAGCAACAGTGCCATCCAGCTCCATAGCCTCCAT
GATACGCACAGGTGCAGCAAACATCTTGGCGTACCGGAAGCGACGCTCAATCAGGTAGATCAGGAACGGAGGTGTGATCCAGATGTACGAGGAGCAGCGA
GCGAGCCATGAAGCAGCACCGTGGAAAGACAGCACGACGAGGAATACCCCGAAGAGCATGTGCGAGTACCAGAAAAGGTTGAACTTGCCCTGGCGGAACT
TCGGGATCGCAGCAAGAGGGAACGAGATACAAGTGATGACCAGAAGAATCGCGCCAGTCCACACTGGGAGGGACTGCAGCATAGTAGTGAACGGAGGTCG
CTCTCCGTTCACGAAGGAAGACACATGCCGCGTCACAAAGATCGACCGCTTGACCTCGTCCGGTGTGGCGACCAGGTACAGGTAGACCTCATTAAACACG
TGGGCAGTTGTGTGAATGAGACCGGCAATCAGCAGCACACTTCCCGAGATCTTGTGGAAGGCAATGTGATCGTCGAACGGGATGTAGCGCCACAAAAACT
TGCTGCGCTTCATGACCTGCGTGATGGAGCGGCACATGGGCAGTAGTACGAACACACAGTTTACCATGGCGACCTGGGCATTGGCTCGGGCGATACGAAG
ACCCCAACCGATGGCAGGATCAACCTCGTAGGAGAACCACTTGACCCAGAAGGCGATGTTGTTGAGAATGACGTAGAACAGGAGCCACCAGATACGCAGC
TTGTTGGCACTGTACCAGGCACCAAACTTGCTCTTCGGACGGATCGGCGCCGTGTATATGGGTGCTGACTTCCGAAGGTTGTACGAGTCGTTAATAAAGG
GGGCGAACACCATCTTGAACTGCTCGTACGTCATTGACTCGTTCTGCACTTGAGCCTTCTTGAACATGAGGCCAGCCACGGTCTTGAAGTCCGTGCCAAC
CACATCAATGTGGGCTGCCGAAAAGTTCGACTCCAGTAGCTGAATGATCTGGTCTTCAATCACGTAGCCGGAGTTGTCCGGGTCCAGCGTCTCGAAGATG
AAACGCAGCTTCTCCTCGCCGTCAACTTCGAGGTCCATGACAGCGTCGATCAGGATAGCGTTACCGTCGATGTCGCCGTTGTTAGTAGCGTAGCCGTCGA
AGTCGTTGCCGCTCAGTTCAAAGGCCTGCGAAAAGGTCTCGCGCTCGATGAAGCCGTCCTTGCTGGTGATGCTACTCATCACATCGCGCAGAGCGTGTAG
CTTCTCCATGGGGGTGTATGCAGGGTCGTTGTTGTGAATGGCATGTTCGTCCATGCTCATGGCCACGTTGTACTTTTGCTCGAAGTTACAGTCGCCGAGG
ACTGGCACCGACACAACATCGGTGCCCGGCTGCGGGCCGTACCTCGAGTCTCCCATTATGTTGAATTTGGACCCGGCGAGCGACGACAGGTTGGATGCGC
GCGCTAGACTCTCACGCACCATGGAGGCGCCCAGCATGGCCTGAACGTTGGGGCGGCGACGGTTGTTGCCGCTGCTCTTGCAGTTGGCGCTCATCTTGGG
CGGGCCGCGGCCGATCATGTGTGCGGTGGTGGAGTTCATGTTGATGAACTGGCTGCTGTCCATGAAGTTGGACTGGGCTGTGCTGTGGAAAGAGGACATC
ATGGCCGGGTGGTTGGTCATGTGCTGCGGCGGTGGCGGCGGTGGGGGCGGGGCCGGTGCGCGCTTGCTCTTCTTCATGCTACCCTTCCGGCTGGCGGTGC
GACCTCCTAGCTTGCGTGAGTTGGGCGACGGCGTCGAGATGTCCACGAAGGGCTGGTGGTTCTGGCCCGGCGTGATCTTGAGCTCGTCCGCGGGCTGGCG
CTTGGGCGTGGCATTCCCATTGCGGAAGCGGTTCTGGCGGTCGCGCTGCATCGAGACGCCTCGTGTCCTTGCGAAGCCGTAGAAAGCGAAGTGTCGAGGT
CACGACGATGGTCCGTGGAGAAGGGAATCCGCGACTGGCCTCGGAGCGTAACGCGGCGTCTCTAGAAACGCGGTGCCTGGGAAACAGGCAAGTGGCACTG
CCGACGGCGTTGCAACGAGGCAAATGGCGAAGTGCCCCAGCGCCCACCTGGTCGGTGCCGCGACCCGTCCGTGCCCGCGGATGACACGTCAGTAAAATGC
AGCCCACCGAACTCGAACATCTTCGAGTTTGTATGGGACGGCTGTTTTCTGGCTCGCGCTGAACCGACTCTGCGGCGGGCTCGGGGATATCTTTCGGCTT
TGCCATGTGTACA