Description :
From Genome Similarity Track
Location :
Scaffold_38:31300- 33167
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_38-snap-gene-0.36WD-40 repeat-containing protein

Sequence
1867 bases(100 bases per row)
GTGGCGAGGATGAGGAAGAATATGAGGACGAGCCGATCGAGCTGCAGAAACTTTtGGCATCCCCcACGGCtCCTTGGAAGCTGCTGGAGGACTCACAGCA
AGCTGTGTGcATTGCCATGAATCGCCGCCAGACCATGTTTGCCATTGGGGAGAAGGAGGGGCGTATCAGCATTTGGGACAACACGACCATTCGGGTGATC
ACGAAGGAGCTGGACCCGACATCAATCATTCTACCAGAAGAGCCTCACAAAGATGCAGAGGTCATCAGTGGGGACgATCGGGATGTGAAAAGaCAAAGAa
CAGAAGACAACATCGGTACTGAAGGCGTCGAAATGcGCCGGcAGTCTTCAGACGATGCAGATGGCTCAGTGGATGGCGGTGATTCAGcGaCCAACGaCgA
aGGCTCGGTGGATGGGAATGTTGATGACGATGGTGACTCGGTCATGAACGATGATAGCGCTTCTATTGAGGACGATGATGAAGACGATGGCGCTGATGGC
GACACAGAAGCAACGGTGGATGCTGATGAGACCGCGTCAGTTGAAGACGGGGgCTCAATTGACGACAATACTGGTGAAGATCGTGGGCTCGGAGATGAGG
ATATGAGCATGGAAGATGACACAGAGACTCCCATGGAGATCCCCCGCAAGTTGTCTGAAACCGGCACGCCCGGTTTATCTTTTGAAGAGCTCAAGATCGC
GAAGAGCTCCCTCAAGCATGTGCTTAGTATCGATTGGTCCTGCGACTCCCGCcTCCTATTTGCTGGTTGTGAAGAGAAGAGCAGTCGGCGGGGACGGCTA
TGCGTGTGGGACGCTGAATCGGCATGGCTGATTGCAACGTTTAGCTTCGATGGTGCCGTCAATGCTGTCAGTGCCcATCCTTCTCAACCGGATGTTGTTG
TTGTGTGTTCATACAACTCGCTGCCAGTTTTATTGAACGTACGAACTCGGGAGACAACAGTCCTTCAAGTTCCTATCGTGAACGATACTCTTACGGTGAC
ACCTCCGCCGAACAGTCGACACCCGTCACTCGTTGTGTGTTGCCGGTTTGGAGCCTCTGGTCGATTCATCTATTGTGCAACGTCCAAGTCTACTGTTGCT
ATCCTCGATCCCGCCACGTATGCTTGTGTCGATACAAAACTGCTGCCAATTCTTGTGCAGTTTGTTGATCTGGCAGTCAATTTGGATGAGAGTGCCCTCG
CATTTACCAGTTCAAAGGGGATCCATGAATTTTCCATAGTTGCTGATAACGAAGGTGTTCGTCTAGAAGAAACAAGGCTCTATTCAACAGGTGCTGTCAG
GGCACCTTGGGCTCTTTGTAGGTTTAGCAGCGATGGTCTGTACGTGGTTGGGATGCCAATCGTTCGTCACCGCCACGTTGGAGAAAGTGGCCTCTACACA
TGGCATCGTGTGACTGGTCGAGTTCAACACAACCTTGGAGTAAAGGACGGAGTTAATTCTATCGCGTGGGACCTACGCCGTGACGCCATCGTCGTGGTGT
CGTGCAACGGTGCCATCCACGTTCTAGAGGAGAGCTTTCGAACTGAGTGGCCTGGTACAATGTATCCTGCCGGCTTCCGGCTGGTTACTGACAACGAACT
GGACATGCAAGAaCTAGAGCAAGAACTGGGTGAGAATGATCCAGACTCAGACCTCGGAAGTGCTGATCCTGCCAACGaGTCCTCGGTGGATGtGTTTTCG
tCTCTGACTCAGGAAGATCCGCATGAACTGAAGCTACCTCCTTTGGAGACTGAGATTTACTATATTCCATCAATTCCGATCACCcAACACCTCAAGCGTC
ACTTACAGCATGACTTCCATATTGAGCGTCACTTCGGGTTAGGCCAAAGTGTGTTCGAGCCACTAAA