Description :
From Genome Similarity Track
Location :
contig_97:31300- 33085
Transcript NameFunction/comments
g10903.t1hypothetical protein

Sequence
1785 bases(100 bases per row)
TGGATGTCTTCTGAACACAACCGGACATAACTGGACACCACTGTACACAACTGGCCATAACTGGACACATCCGCAATCTTTCCATCGCGATTCCTCCAAA
CGCGATCTCATGCCATCAGTCCCTTCCGAATCGCTCAATCTCTCCAACTGACAAGTCGCTTCACCTCAAGTGCAACTAGATCCTTTCGAAGCTCGACGCC
AATGCACGTTCTAACGCTCGTCGCAAGTGCAACTTGAGCGACAATGTTGCCCACACCAGCTCCAACATCGAGGAAAACGTCGGCTTCTCCGAGGGGTCCA
ACAGCTTCAAGTATCTTTGAGACACCCGACGGTAACACCTCACCAGCATTGCCATAAGTACGGCCGGCTTGCTGGCGGACATCGTGCGCACTGATTCCTG
CAAATATGAGATTCACAGCTTTCGCTGCTTGCCCTGGGTTGAGTATAGTTTCACGTGACTCAGCGGCGACGCAGCCCGCGAAGGTGGTACTGCCCACAGA
CTTGAATATGGTGTGGCTCACCGGCTCGGACGTGGTGTTGACCGCAGACGTGGCTACGGCGGCGATCCCGACACGGTCACCAGCCTCGGCGGAGAGGCTG
GGCATGGTAACGGAGCCGCGCACGGACTTGGTGGCAGCGCGGTCTGAAGCCTTGGCCTTGACGTCCATGGCGGCACGGACACCAGACTCCGCTGCGAGGC
AGCTGGTGACGGCGGTGTCACGGACAGACTTAGTGCGCATGACCTCGGTGTCGGTGCTGCTCGCGGGCTGGTTGGGGCTGTTGCTCGCGGACTTGAAGGA
GGACCCGGTGTCGGTGCCAATGGCAACACCACCGCCTGATCCGTTGGAAAGACTAGCCGAGGTTGTGGTGGAGGGCGTGAGGCCGAGACGGGGAGGTGGT
GCGTGCGTCGGCGCTATTAGTCGCCGGGAAATGGGGAGAGATGGCGGCGGCCGAGCTCGCGCGACTAGAACTCCCCTGGAAGGCAGACCACTGAAAAAGC
ACCGCGGAAAGCTGCTTATGGTCTTCCCGTACGTCCTCTTGAGACTGGCCAGCCGAAGACGGAGCTCGTTCGCAGAGCGCTTGGTTTTCATCCGACGGGC
CACATATGCCCAGGTGATGCGAAGGCCTTCCCTCTCGAACTGAAGTGTGATCTGGACCAGTAGCTTGTCTTCTTTGTCAGTGAAACTTGTGCGCATTTCT
GCTAATTTTTGTATGTGAAATGAAGTCAGCATGTAGTGCATTTGACTTACCTTATGTATGGCGATATGACTGGCTGCACGGTGATACTGGTGCTCATTGT
TTTTGCAGCGCTTGGTCGATGACGCGGCGGTGCGGCTGCGACCGATTACGGCGGCTGAAGCAATAAAATACACCTCGGAGACGCGAGCATTTGAAAAATA
CCCCCATCCCTCTTAAACAAAATGCTGTGATTGGTAGTAATATTACACGGTAGGTCGAGCGCGGGATTAGGCTAAAAGGGCGCAACAATCGCCCTTTTAG
AAGTCCATTTGTCACCGTGTTTTGGAAACAGCGTTAAAGGGCGAGAAATGCGCCCTTGCACCGCGAAAGGGTTAATTAATTAGCTAAGTTCGCTTTCGTT
AATTTGCTTAAGTTCCGACTTGCTTGAATATTTTTTTCTTACGAGCACGAATTTCCGTTCGATGCTTCTCATCATATTCTCGCTGCTTCGCCAGTCGCGT
TTCCCTTGTCTTTAGATAGTAGCGCCTTGATGCGCTCTTTATTAACCCCCCAACGCGAGGGCCTGTATCAGACACGATTCTTCAA