Description :
From Genome Similarity Track
Location :
Scaffold_949:3130- 5535
Transcript NameFunction/comments
Phypl_g11783conserved hypothetical protein

Sequence
2405 bases(100 bases per row)
GAGGAAATGCCGATAAAGGAAGAGGCTGTTAACCAGGAAGCGGTTCCTGAGGTTAAGTCAGAGCCtgctgaagaggaagaagaggatgaagacgattTGT
TCCTTTATGGTGCAGCTCCTACAAAAGAGGaaccggcagcagcagttggtCCCACGGAGACTGCGAACGGTGTGAACGGATCCAGCGTGAAGAAAGAGGA
GAATGATTCGTCTTCTGAGGAATACACTGGCCCGTATGATTATGAGCTCCGGCAGATTGATGTGCTACCAAGTATCGGGCCGATCACATCGATCGAGTTG
GGCGTCGAAAACAATGCCGACTCGAATGAGAAGCGTGAGGAGCTTGTGATCAGCGGTGGGTATGAGCGCAGTGGCGCCATCTCGGTGCTACACAACGGAT
TGCGCCCTATCGTTGGCACCGAGGCTGAGCTGAACGGTTGTCGAGCAATGTGGACGGTATCATCTTCACTGCCTTCTGCGACAAAGAGCTCGGATGGCCG
GAGTTACAACGCGTACCTGATCTTGAGCGTTGCTCAGAGAACAATGGTGCTGCGAACTGGCGAAGGTATGGAGCCCTTAGAAGATGACAGTGGTTTCTAC
ACGTCCGGTCCTAcccttgctgcagcaaattTGTTCAACAAGCAGCGAATTGTTCAAATATTTAAGCAAGGCGCACGGGTGATGATGGAAGTACCCGAAG
AGGAAGCACCAAATGGGCAGGAGAAGGCAGAAAAGGCCGAGGGtgctgaagaggaagacgatgacgacaaAGATGACGGCCCAAAGGTCAAGCTGGTTTG
CACGCAGGAGATCACTCTGGAAGGTGACGTCGAGTGTGGAGGTATGAATGTTGACACTGCAAGCGTAGGAATCGTGTCGGTGGATGTTGTTGACCCGTAC
ATTCTTCTGCTTCTGACCGACGGCTCGGTTCGTCTGCTGATgggagacgaagaagacatgGAGCTGACTGTGATCGACCCGGAGATCGACTATCTTGACG
GCATCACTGACTCGAATGGAAGCGCAGATGCGTCCAAGCATGGCAGCAGTTCTGCTTGCCTCTTCTACGATTGGGCTGATATGTTCCGTGAAAACGCATG
GGgggaggacgagcgcgaagAGCGTCGTGAATATGCTGCAACAGAGAGCAAAAAGGAAAGCGCccgtgacgatgacgatgacaTGGACGCATTGTACAGC
GCTAGTAAACCAAGTCCAAAGGCGGCCACGGCTATCCGCAGTAGCGCGGCGAAGTTGGTGCCGGCCCTAGCTGCACAGAAGAATGCTGACGGATCTGTAT
CGATTCCGCTGCTAAAGCAAAAGGATGCCAAGATGATGTGTGGCATGTGCTTCGGAGATGGTTCTCTTCATGTGTTCTCCCTCCCTGAGTTCAAGAAGAG
AGGCGTGTTCCCGTATCTCACTTTTGCGCCGCAGTCGCTAGTGAATACGCTCGAGCACTACCAGGTCAGCAAGAACAAAACGGTGAAATTCTCTGCCCCC
GTTCTCGGTCTCAACGCATCGACATCTTCAGCGAACGATGGTCGTATCAAGAAGTCGCATACGATTAATTCGCCGGTGGCAGACATCGTCATTCACCGCG
TCGGTCCTAGCGAAGGGCAACACAACGCCCAATACCTCTCACGGatggtgatgctggtgttCCTAGCCAACGGCGACTTGCTCATGTATTCAGCGACACC
GAAGTTCGAGAGTTTGAAGCCCAGAGCCAACGGGGAAATCGCGCCCGTGTTCCATTTCGTTCGCGTGGGGACCGATCTGATCACGCGACCATTCCTGCCC
CCGAAAGCACGCACAAGTTCTCACAATGAGGCTGGTAGTAACCCGGAGGTTAACACTAGCGCCGTGTTGGCCAAGCTCCGTGCTGGCTTCCGTTACCCTA
TGCTGACATTCTTCTACAACGTCAACAACATGAGTGGCGCGTTTTTCCGAGGTGCGCACCCAATGTGGATTTTGGGTGATCGTGGACAGCCGTCTTTTAT
CCCGATGTGCGTCCCTGGCTCCGCTCCGCCTGCTCCAAAGGCAAATGGTACTTCCAACAGAAACGCTACTCCGCGGGTGAGCGTGCCAGTATTGAGTTTC
ACGCCGTTTCACCACTGGAACTGCCCGAATGGATTTATTTACTTCCACTCACGCGGTGCGTTGCGCGTGTGCGAACTTCCTTCAAGCAAGACGTCAACAA
TTCTGCCATCAAGCGGTGGTTTTGTGCTTCAGAAGGCCGAATTCGGCGTAACCTTGCACCATATGCTCTACCTGGGCAACCACGGCCCCGGGGGTGTTGC
AGAGGCGCTTGAAGCGCCCACCTACGCTGTCGTTTGCAGTGTGAAAATGAAGCCTGCTGACGCAGAACGAGCCACGGAAGTGGAGGGTgcagaggaggag
cagga