Description :
From Genome Similarity Track
Location :
Scaffold_2446:3130- 4891
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2446-fgenesh-gene-0.1Omega-3 fatty acid desaturase, endoplasmic reticulum

Sequence
1761 bases(100 bases per row)
TGTGTGGCATGCATGCAGGTCTTTTCGCTTGGCTCGGCCTGGTTCGCGTACCTCTTCGTGGGCTTCCCGCCTCGCACGATGAACCACTTCAACCCGGTAC
GCCCTCATCTAATCATTGAGTCTCTTACGCGGCATGCAGTTAGACTCACTCTTGCTATGTCTCTAAATGCAGTGGGAGGCCATGTACATGCGACGCGTGG
CGGCCGTGATCATCTCAATCGGCTCGCTCTTCGCCTTCGCGGCGCTCTACGCGTACCTGACGTTCACGCTGGGCGTCGCGACCATGGCGCTGTACTACTT
TGGCCCGCTCTTCGTGTTCGCGACGATGCTCGTGGTCACGACATTCCTGCACCACCAGGACGAGGAGACCCCGTGGTACGCCGACTCGGAGTGGACGTAC
GTCAAGGGCAACCTGTCGTCCGTGGACCGCTCGTACGGCGCGCTCATCGACAACCTGAGCCACAACATCGGCACGCACCAGATCCACCACCTCTTCCCCA
TCATCCCGCACTACAAGCTCGTCGAGGCCACGGCCGCCTTCGCGCAGGCCTTCCCGGAGCTCGTGCGCAAGAACATGTCGCCCATTGTGCCGGCGTTCTT
CCGCATGGCCGCCATGTACGCCACGTACGGCGTCGTGGACACGGACGCCAAGACATTCACGCTCAAGGCCGCCAAGGCCGCCGCCAAGACTAAGTCCAGC
TAGGCTGATTGATTGACACAAGAGAGAGAGAGAGAGAGAGATGCAATGGGCATCTGAACAAAGAGAATGAGAAAGACCCATTTCGTGTGACCCTTATACT
TTCAGCTGTGTCTATCACCAGCGCATAGCCACGAACCAGAGGCCACCAGCTCATAAACCCAGCAGCACTTGAGAGCTCTGCAGAAATGACCAGTCATGTA
GCTGCTCATGGGATCCTGAGTTGGAGGAACGAGGCGCGAAACCGCCAGCAAAAATGACAGGGCGAAACGGTGAAACAGTCGCCACGTCTTTGTATAAAGG
ACATGCTCATCTCTGTTCATGACCATGTCGCTTGTATAGAGAAAACTCTGTACAGACAAATTGCGAACCTCGGACCGCGAACCTTGGGCAATTCTCCAAG
GTTGCATGCTTCTCTAGGATAGCAGCTCTCTCTCCCTCTCTACATGTGTGTGTCAGTACTCAACGCGCCATGGCTACGAGGTCTCAGACATCATTCGTAT
CACGAGCTGTGGTGGTTGGCACTAAAGCCTAGTGACACCACCAGCATCAACACGAAACAAAAAAAGAGAGAACTGGAATACAAAGTTAAAACAAAATATT
GGCGTTCGTCGACTGTGAGTTCTCGTAACTTGGCGTCTCCCTCTGCATCCTCTCTACCGTTCGAGATTCCTCAGAGGAGTCCGCACACAGCTCTCGAGCA
CAAACCACAGCGGACGACGAGTTCACCAATGTCTTCTTTTTCCCTTCTTCTCTTCTTCTCTTTCTACATGGACGACAACAAATCCGCAAGAGCAGGCGGC
GGCGAGGATGGCTTGGGGACTGGAGCAGCAGCTGGGGCACGAACAGAAGACGATGAAGTCTGGTCACGGCGCGCGGGCAGGAAGCGGCGGTCGGCAGGCG
GGCAGACATCCATACTGGGGGACGACCAGCCACTGGATGTGGACCCAGCGCCCGGTCATCGCACAAAACTCCCCAGAACTGACGACTCCGCTGCCAGCCA
CTCGCGTTCTGCTCGCTCGCTCGCTCTCCTGGCGGCCACATTTACACACTTCACGCACTCT