Description :
From Genome Similarity Track
Location :
Scaffold_1435:313- 2097
Transcript NameFunction/comments
Phyke_g11862hypothetical protein PHYSODRAFT_315936

Sequence
1784 bases(100 bases per row)
GGCGCCAACGACAGGGGGAACAAGTCGTGGAAAAGTTCCCAAATGGGACTGTGTAGGTCATTGTCAAAGCGGGTCACACACGGTGCGCGATTTGAAGCTA
ATGGTCTACAATATTCGTATGTGCTAGCGCCTATTGGGCACCCGAAATCATTTTACACCGGCCCCAGGATTTCGGCGTCGATATGTGGGCGTTTGGAGTG
TTGGTATGTTTTAGCAGATAGGACATTTATTGCTGCGCGGATATAATATAGGTGAGGCTATGACTCACACCCCGTTTTGCATGCGCTTTAGGCATATATC
ACGCTCACGGGAGTACACCCGTTTGATCCTAGAGGTGATAAGTCAGATGTTGAGATTGTGAAGGAGATCGCAAAAGGAAAATACGATGGTAGGGATGGTA
GACGGGTGAATGCCGACTTATATCTCACTGGTACTTACGTAATGTTGTTCACTGGTCAATGGGTAGTGTCCAACAAATGGTACAAGGGCCTCTCTACAGA
TGCAAAAGACTTTTTGACGCAGCTACTGCATTTTGATCCGTCGAAGAGGTTGACTGCTAAGCAAGCTATGCAGCACTCCTGGCTGAATGGCCACACTACG
TCTACGGATCCATTCGACAGTGGCCATAGCCAGCGTCTTCAATCGTACCAGCGACTACAACAGCTACGCGCCAATATTTTGACCGTCATTATGGGCGTGC
AGTACGCGAAATTTCGCGAGCGTGGCGACACTGGTGATGGTGGAAAGCAGCACCTCGCTTCACGTCGAACGTCAACCGTAAATATGGATATGTTCAAGGA
GGCATTTGCTCTCTTTGACAAGGACGAGTCGGGCTGCATTGACCGGAATGAGCTTCGAAGCATGATGCTTGCTCTGGGGCAACAGCTTTCAAGGTTTGGT
CATGGCGTGCGTCGCTTGCAGTCGAGCTCATACTAACCGAGTAACCTTTGCTGTTGTGGCGCCCTGGAAATTAGCTCGGAAATCGATGGCATTATGCAAG
TAGCAGATGCCGATGGTGACGGAAAGATTTCGTTCACCGAGTTTGTGAGCATGACGAACCAGCGGCTATTTCGTCGGCACGTATTGTTTCCGTCTCGCGC
AAATGTATCTCGGAGTTGTATGACACAATGACGATTCTGACAACACTTGTGTTGTATTACAGTGGTGCCTTGACATCGGGGGATCTGAAAGCTGCATTCG
AAGTAAGTTGTGCTTAGCTTGTCATCTGAAAACTTGGTAATGAGGACTCACTTTGGTCTTTTGAATGTTGCTGTTTTCGTCCAGACGTTTGATGCCAATC
ACGACGGATTCATTTCCAGCAACGAACTTGAGCACATTCTGCATGTGCTAGGCAACAAACGCATCGGCAGAGACGAAATCTGCAAAAtcatccaagcagc
agatAAGAACGACGACGGGAAAATcgactacgacgagttcTGCGAtctgatgcagcagcaaaccaagAGTTGACGATTGATGACGTGCGTCATGCGCTTT
GTGAGAATTGATCTGTTGGCTAAAGAGCAGACACTGGCGTTCTCTCAACGTGGCGAACGATGGTTTGTGTGAATACCAACAATCTGTGCGAATTATTGTG
CAATTTCTGTTGGTTCCGGTGTTTTCGTTTGGGTTTCAAGCCGCCAACGGTCGTGACTCTAACGCATGTGTCTCGTAAGGCGGTCGTTGGTATTCCCAGA
GCTGTTTGTATCTGTCTCCACCTGACGGAATGCCTTCTAGCACACTTTGTAGCCAACTGTTTGGGGTTGTCGTAAAACGTGATC