Description :
From Genome Similarity Track
Location :
Scaffold_220:31297- 32303
Transcript NameFunction/comments
g15991.t1hypothetical protein

Sequence
1006 bases(100 bases per row)
AGCTGGCCAAACACCGTGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGAT
GATCATGAGTTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCTGACATCGGGACATCCTGGCCGTGAGAAGACATACTTGCTTCTCACGCGTGACT
TCTACTGGAGTCACCAGTACAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCATCACGTTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCA
ATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGGTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATAGTGGTCTTT
GTTGGCCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTTGACCTGGTGTTTAGACACC
ATGGTATGCCACTCGACATCGTGTCGGATCGGGATCTGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTC
GACTGCGGATCACCCGCAGACCGACGGACAAACCGAGCGTGTCAACCGCGTGTTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATCGAGC
GACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACCCACCCTCCTTCTACGTGAATGTCATGAGGCACCCACGCG
TACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAATGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGTACGCTGATACGAGCAATGTATC
AGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAATACAGTGTCTACGACGGGCGTAGACACTTTGAACCACAACGAACATCATGCG
CAGGCC