Description :
From Genome Similarity Track
Location :
Scaffold_231:3129- 4534
Transcript NameFunction/comments
Phyca_LT1534132782Hypothetical protein

Sequence
1405 bases(100 bases per row)
ttgcctattctttgcacttcaacatgcactgcaattggctggcgagccttttggtgttcgggattctcacgtccaagattttctagctagagctacagag
ttgcatcaagacctttctcgtggagtatcttggaaaatatttcgtgcatttctagtgcagttacatgtggctggttctcgactttcattggacgaaattg
aatttaaccggcaccgtaccggacaccgtggtgtttctgctatagtacgtctctccttggaggacggtgtttacttggttgctgccagtaacactttagc
agttggacatgcatttgtcctccaggtccgtggagcccagaggacagttttcgacgactcgtctcagcgccctttggtcgactacggtgagtggatcgac
agagtgatgtttgttcgtaaagttgcacttttagattaagatcaaaatatatttttgatttgtttaccttcacttttgttctattgtaaaattaaatgta
catgtatattcggcggctgtgtgccaggaaaaaacactttcagtgtaaaaaccttatcgaaaagtaactgagaaaacctttgcatgtaagagttcttaaa
ggaaaaaactcatgttactacgtgactctttaaaagttgtgaggtaatacagtatataaatggtgaaatttatcgtgtattttaaagtatgtttaactgt
taagtttagcgagagagtgcatacctaacttgtttcttaagtctctaaattggtgcttatcaagggctttagtaaaaatgtctgctaccatcgctttggt
attgcaatactcaatacaaaattcgcatctctcaaccttttcctgtacaaagtgatatcgaatatcaatgtgttttgatcgtccgtgtagttcgggatta
tttgagatcttaatgcaactttggttgtcttctttaatcgtgactgctttcgtggttgtgaaaccgagttccttaagtagtaacttcaggaatatcagct
cctgcatgcaatgacacaatgcaatgtattcagcttctgtggtcgacagcacaactgtgtggtgctttcttgaaagccaggatattggactttggcctat
catagtgatgtagccacctacagagcgtctactgtcaggacagttagcatagtctgagtcggtgtaagccgtgaggtgatctgcaagattttctgtgtta
accgttcgtgatcctcctagtagtagaccaagatcctctgtaccagagagatacttaagccctctaatcactgctttccaatgttcctgtccaggattag
caagaaattggctaacatcacgcatgtagaatgctaggtcgggtcttgtgccaaccannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnn