Description :
From Genome Similarity Track
Location :
scaffold_59:31284- 32696
Sequence
1412 bases(100 bases per row)
GCTTTCGCAAAGTCTAAAAAGGTTGCTAAACCTTCTCGATCCTCCGTGGTCACCAGGTGCTGGAGGTCTCGTACCAGCATCACTTGGTGTTGAATTGAAC
GGCCAGGTATAAATCCTTTTTGGTCTGGGTGCACCAACTGGTTCATGTAGGGACGAAGTCTGTGTGTTATCACACGAGACAGCACCTTTACTTCAACTGG
CATCAGCGATATAGGACGATAGTTCCCTGGGTCAGCTCTATCTCCTTTTTTAAATAGCAAGGCAACCGAAGAATAGCGTTGATGGGGCAATAACTCTCCA
CGCTGCAGCTGATAACAAAAGACTTCGCGTAAAATTTCTCCAAACGTTTCTGCATCCAGCTGATAAAATGCTGTCGTAAATCCATCAGGACCAGGAGCCG
AGTGGGTTCGCATAGAACGAATTGAAGATGCGAACTCGTCTCTCGTAAAATCTTCTTCAAGGCTTTCCGTTGCATCTGGTGTAAGCTCACGATTAATTGA
TTCCAACAGGCGTTCTTGAGCAACACTGTCAGTTTCTTCATTCTGCAGCGAAAATTGTCGATCAGCAAATATTTCTCCCCAATGTCTTTGAAATCCTGTC
GTGATATCAGCAGGATCAGTCGAGACCGTACCATCCATCTGACGAATGGTACTTAGAGGAGTTTTTCGAAGTTCAAATCGAGGTGCACGAAAGAAAAACT
TTGAACTTTTCTCTCCTTCCGTGACCGTGCGTTCAAATCCAACCCTTTTCCTGAAAGCAGTCCATTCGTCTTGACACTCGTCGAGTCGTTTCTTAGCAAA
ATAGTAGTCAATACTGGCTTGGTCATTTGCGTCTTCCTGCGCTACTGCTTTTGCGCATTCTTCAACGTGATCTCGTGCGATTTCAACATCAGCGTACGTT
GCTGACCGCAAGTTTCGTTGGCACCTTTTCAGGTAACATTTCATCTTCTGCTTCCAGACTTTCCATACTATTCCCGGATTGGCTGACTCTCTTAAGACTG
GAAGAAGCGCTTTTGCCTCAGCAACAATATCCTCACGTAAAATGGGAATATCAAGAAGCCACTCAGGCAACTTCCAGAACCCAGGCCCAGTTGGGTGGTG
CCACGAAGTGAGCTCCACTTGGTGCGCCCGATGGTCGCCATAATCCCAGGTTTCGTAGCTCGCGTCATGATAACACTCCGCCAGTAAGGAATCGGACAGA
AAAATGTAGTCAATACGATTGCGCCGAGGGCGAGGCCCCGAAAAGACCCGATCTTCTGGATGATGAAGACGCCATGCATCAACGACATTAAGCTCCGATA
ACCACGTTAACACTGCCTGCCTGCTATTATCAGGTCTCGGGTGGCTCGATACTGCATCCAGGTCAGGATCAAGTGCTAAGTTGAAGTCTCCACACACGAT
GTGTACAGCATT