Description :
From Genome Similarity Track
Location :
contig_10:312800- 314566
Transcript NameFunction/comments
g3486.t1XP_008916809.1 hypothetical protein PPTG_19948, partial [Phytophthora parasitica INRA-310

Sequence
1766 bases(100 bases per row)
TGGGAGGCCAGGCCCCGCAAGTACAAGAACGTCTTGTTTCAAGTCTGTTCCTTCATCCTCATGATGGAGCTGGCCGAGCGTCTCAGCTACTACGGCATCA
ACCAGGGCCTCAAGAACTTTATGCAGAAGATCGGCTGGAGTCTCGTCTCGGCCAGCGCCTTGAAGAGCACGTGGACGTCCATCTGCTACCTCACGCCGCT
CTTCGGAGCCTATCTGGCCGACGAGAAGTGGGGCCGCTTCCGCACCATCCTCACGTTCGGGATCTGGTACTGCGTGGGCGACTTCATGGTGGCCATCGCT
GCGTACCCGACCATCATGACCAACTCCGCTGCAGTGAACCCCATCTTCATCATCGGTTTGTTCGTGGGCATCGGCATTGGTACCGGTGCTATCAAGTCCA
ACGTCATTACTCTTGGTGCCGACCAGTTTGATCCGCACGACCCGAGCGAGGTGCACCAGAAGGAGACGTACTTCTCGTACTTTTACTTCTGCATCAACCT
CGGTTTTCCGGCTTCTCGTACGGCTACCTGTCGATCCTGTGTGTGGATGGCTCGGCTCAGATCCCAGCCGAGTACGGCTACTTCGCGACGTACATGATCT
GCGCTGTGGTGATGCTGCTGGCTATCATCATGCTGTGCGTGGGGTACCCCCGCTACGTGTTCCAGCCGCCTAACGACCGTTCCATCTCGATGCTGTGCCA
ACTGGGCTGGGCGAACGCGCACCAGACTCGCAAGGGCCTGGTCCTCGTGGCTAGTTCGTTTAGCTTCCTGGGTGCGCTGGTCATCAACGTCATTGCTGCG
TTCACCGCCTCTTCAGGCAACGTTGGCAACGTTTTATCGTACGTGGCTGCAGTGCTGGTACTTGCCGGTATCGTGGGCTGGGTCCTACGTCGGCCAAGAT
CAGTCCTTCCTGGACGCGTCCAAGAGCAGCATGGGCGGCACTTTCGACGACGAGCGCGTTGAAGGCTACAAGAAGCTGGTGCGTGTGCTGCCCTACGCCG
CCTTCACCATTATCTGGAACTGCGCCTACGACCAAACCGATGCCAACTTCCAGTCCATCACGCAGCAGTGCGACCTGCGTCTCGACACCAGCGACCCGGA
CAGCTCTCAGATCCCTGGCGCCATGCTCGGCGTCTTTGACCCTATTGTCATTGTGATCTGCATCCCAGTGCTGGACTCCATCGTTTACCCGGCGTACACC
AAGTGGGTGGGCAAGTCCCCCAGTCAGTTCGGCAAGTCCGCAGTGGGTCTCGTTGTCGCTATCGTCGGCATCTTCTGGGCTGGCATCTTCGAGGTCATTC
GCCGTAACGCCGGTGCTCTTGAGGACGCAAACGGAGACCCGATCCTGGACGGTGGCAGCTCGCAGCCCATGAACGATATCTCGTGGGGTGCAGCAGTTCC
CAACTACGTCTTCATTGGTCTGGCTGAATGTCTGATCAACGTCACCTCGTACGACCTTGTGTACTCGAGTGTCCCGATGTCGCTGAAGTCCATGGCGCAG
GCTGTGATCCTCTTCATGAGCTCCATGGGAAGCATCCTCACGTCGGTCTTTACCATCATGTTCTCCAAGTCACTGCCGTCCGACAACCTGAACGAGGACC
ACCTGGAGAACATGTTCTTCACGGTGGGCGCTGTCAGCGTCATCAACTTCGTCTTCTTCGTGATCGTCATGAAGAAGATGAACATGGGCATGTCTTCGTC
CCCAGAGCTCGACCACCTGGGCAACGAGATCCAGGACATCTTGGACGAGAAGGTCTCTGTGAGCTC