Description :
From Genome Similarity Track
Location :
Scaffold_1147:3128- 4986
Sequence
1858 bases(100 bases per row)
ACGGCCGCGAGAAAGAGTCGAATGGTTCCTTGACGTCCGAGAGCGAAAGTTGAAGAGTGAGTCCCGATGCTGGACAAGTTCGACGATGCGGCTTGGTAAT
GGTGCTGCTGAGCGTCAGCTGGAGGCGAGGGTGCGAGCGAAGGGGGTTCGTTGACTGCGCAGGCAGGCGGGATGCGCGTGCCGGTGGGGGAGGGTTAATC
CCTCGCGGTGCGCGAAAATGGGCCGCTCGTGCCGTTCCGATCTTGTGGACCGGTTGACTGCGCTCAGCGGCCCCGCATCTCCATCTGACGCGGCACTGCA
TCCAGAGCGGGATTAATGTGGTGGCGGTTAATTTGTATATACGAGCGCGGCGTCAGTCAAAGTTCCATGGAGTCTTCACCACGGAGGCGACAAACCAGCA
TTCCCAAGCGGCATGCACCTCCGAGTCCTACGATGAGTTCGATCGCTCCGAGGTCTCGGCTCAAGCTCAGCAACGATCGAGTCGACGTTACCAGACCCAC
GGGCGACGAATAGTTGACGCGCCGCGCATCAGAGGCGGTGAGCTGCGTTACCATCTTCAAGCACGGCCAGGGAAAGGCGGCGCCGAGGTGAGTCTTGCAT
TTGACGTGAGAAAGACCAGGCCTCCGCTGCCACGGCGCGTCGGTCATCGCCGGCTGGCTGGCTGCCACGCGAGAGATAGGACACTCGAGGACATCCACCA
GCGTGCGAGTCAACAACACCGAGGCCAGTTGGTGGGCTCACGACGCAAAAGTCTACTGCGCATTTGGCTGGACGATTGAGATTGCATCGGGAGGATCCTC
GGAGCATAGCGCTTCTTGTACTGGAGGATGGCCGCTGATGAGTGTACCGGACTATCCGCCGGTGCGAGGGGCGTGGGTTCTTGTCGTCAACTCCCTCTCG
TGATGGCATGCACGTCAGCGCGGTTGTCACTGCGGACGGCGGCGCAGAGGCAGGCATGCACGACCGGCGCTTCTACATACACTCGACATGGTGTCGAGGA
CAACTTGAAGTGGCAACCCTCATGCAGCAACTCCAACGGCTCCAACATGAAGTTTAGCCCATCATCCCTTCAACTGGCAACTGAGCATGAAAAGCAACGT
CAAGGGCAACATGCGCGGCAGCATGGCTGGCGGCGGCGCCAACGCTCCGGGACCACGCAAGCGGCTCAAGACGTGGGCGACAGCGACCGCCAAGGGGAAG
AGGAAGCGATCGGGTCGCGAGCGTGGCCCAGTTGGCGAGAATGCGGTCCAAACGCCAAAGCGGAAGCCTGCGACAGCAACATCGAAGCAAGGGATGGCGT
ATCTACGGCGGTGCGAGAAGGCCAGGAACCGGTGGAGCGGCTGGGAGGAAGACGGCGACAGCGCCTCCCTTGCGGTGCAGCTCGACTTCAGCGACTTCTC
CATGGACAGGCATTTCGAGGCTGAGGAGCGCGGCCGATCGAACGAGCAGGAACGAGACAAGGAGAACCTCGCGCCGTCAGATGCTAGATCGACCACGCTA
TTGGCTGCGGCCGTGACGGACACGGTAAGACCTTGCTGTCGTCGGGATCTCTCAGTCAACACTCACGTGTGTCTTGTGCCAGCCTTTCGCTCCCAAGAAG
AACGGCAAGGCTTGTTTCAAAGGAAGTGGCTCCATCAAGAACAGCACCAAGAGAGCTGCACTCGACAAATCCAAGACATCCAAGCCGCCTTCCTCGACCA
GAGCGATGCGGAAGACGTGGGAGCTGCGGTCGCCGGCAGAAAGCGCTGGTCGTTCAGTAACCCTAGTGGCGCAACGACCAGCCAGCTCGCATCGGCCGCA
TCGTACGCCTGGACTCTCAGAGCCTCTGGAACAAGCCGCACCAGCCGCCAAACGCCAG