Description :
From Genome Similarity Track
Location :
scaffold_15:31259- 35174
Transcript NameFunction/comments
Pl_112297N-acetyltransferase, putative
Pl_112298hypothetical protein PHYSODRAFT_498950
Pl_112299conserved hypothetical protein

Sequence
3915 bases(100 bases per row)
GTTTATCCTTGGTGACCAACTCCATTTCTACCTGCTTGAACGCTGCGACGTAATTGTACTTCACATACCCCAGCCTGCATCACCAACATGGAATCAGAAG
CAATGAAACACGCAGTCGTGTATTGCAACAAACGAGAAACCAACGTACTTTTCGAAGAGCTGAATCGAAGCATCATTTGTCTCAATGATCTTGCAAATGA
ATCGGCTAACTTTGAGCTGTGACGTAGCTGCAGAGACAATAATAATCAATTAGAACTTATGTCAGTCCACATCGTTATACTAGCATCGCCAAGCATTCAT
ACCGTAAGCCATCATGAGCTTCACTGCCTCCTGTGCGAAGCCCTTGCGGCGGTACTTCTCTTCAGCAATCATGATCTCCATCTCGCATGCATGAGGATCA
TCATAATCGTTGAAGAACAAGTTCACGTCCCCTGCCATGCCTGCATCAACCATAACAGCGATTCAGCTTTCACACTCCATTCCAAATCTTCCACTGAAGC
AACAACGTACGGTTAATGGCACGCTCATCGATGTATGATGAGCCGGGCTTGCCATCATCTTCGTCTTTCGCCAACACGATGAAAGTACACTCTACACATC
ATGTCAATTCACCCACGTACTAGTATCCACAAACTTGTCATTGGATCTCGTACTCTCTGCATCTTCTCTCCACGATTTCTGCATCTCGAACTCCTCCTCA
ATCGAAAGCGGCTCGGACGCTGTCATCTCTACAACAGACACACAACCATTGCCAAAATATGAGCTAATTACACCAGAAATACTAACCACATTGACGGCAA
ATGTTCTCGAATGAATTATTGGCTTGCCTTGCAACCAGGGATCCTTCATCCAGTTGTGGTACTTGGTCACATGCTCCTTCTCGTAAGGCACCAACGTTAC
CCACTGTCCAGTCTGCAGTTAACATCACATTTCAACGCAAAATAATACAAGAAATTAGAGACTATCTCCATTCATCGAATTTAGGCTCAGAATGTGCAGT
GCTCGTACAATGACGATGCTTGTATTCGCTTTCATGATGACCGCACAATTATTTTTGAGACCAATCAGAAAAAAAAGAATGTGGTGTGGTGCACACTATA
TCATCCATCTGATCGTGACAATCATTTGGGTCAAATGAGCCTGTCGGATGCTGCGATCGACACGCAATTTGGGGAGGTTCTACCTGTCCTTATTCGATAC
GGATGGATTCAGGTAATTTATCACGTTTTTCTTGTTAAAATGATGTATAGGTGTATAGGTATTGACGTCTGAGTGTGATGGAATTGCAGGTTGATACAGT
GGAGGATGTCGCTGCAGTTAACAGGAGCTTACGGACGCTAGTGGAGCAACGAAAGCTGCGACGATTGGCGATTCAAGTTAGTGGATTTCCCACTGAGTTG
AGATTTCGGTGCGTAATACAGCTATCAAGTTACACATTGCAGGAGATGACGAGGTACAATGTTAAAGGTATTGGCTGCGAGCTGGGGACGTGTCTACGCT
GATAAAGGAAACACCAAAGCAACTGAGTAGCAGAGCATTATTCTTGAAGGTACAACAGATTTTTTACATTTTATGAAGATAAAGAGTCGACTAAGTGATT
GGATGCTGTTAGTTGACTGGGATGGAGAGTTTAGAGGACAAGGCGACGCTGGAGACGACGGGTGTTGAAGGGGAAATTGATCGAGATATCGAACGTACTT
TTCCATCAAACCCTTTCTTTTCTGAAGAAGGTTAGAGGTTTTTATGTTATATGAAGAGGGTGGAATGTATTGATATTTATGCTGGTGTGTTGTTTCGTTA
GGTGATGGCAGACGTCTCCTTGGAAATGTCCTAAAAGCAGTCGCTGTTCATGCAAATGACGTTGGCTACTGTCAGGTGCATTGGAGTATTTTTTTATTTG
ACTTTTTCATGGAGATGCTTATATTATTGTTATGCATTGAAGGGGATGAACTATGTCGTTGCTGCACTGTTGTTATTGGTGAAAGATGCTCAAGATGTTT
CAGACGTGGACATCGACGGACTCTCTGCTCAAGAGGTGGTGTTTTGGTTAACGCTCGTCTTGATTCGGCGCAAGGGGATGGCGAATCTGTGGAAGCACAA
AATGCCAGGGTTTGTTTTTTTATTTTTGCTGGGACGACAGAAACTCACGCTGGAATTTTTGCTGCGTAGTCTATCGCAGTGCATATATCTTTTTCAGCAG
CTCCTCAAGCTTCACTTTTACGATTTATCGGCACATTTTCGGCAGATTGGAATGCATTCAAATATCCTAGTCACCCAGGTAAACGCAAACGAGGGCAAGT
CCCATGTTCGTGTTGCGTACATTGTTACATGTTGGAAATGCACCTCACAAGGAACGTGTTTGTTGTAGTGGTTTGTGACGGTATTTGCTCGTGTTCTAAA
CACCCCAACTCTAGTCCGAGTGTGGGACCTCGTCTTACTGGATGGCTGGAAAGCTATATATCGAGTCGCTCTCGCCATTACAGCGGAACTGCGACCAAAA
CTTCTCGCAATGGTAAGTTAATAAATCGTCGGAGGGCAGCCGGATATCGTATCTGACGGGATTTTTCTTTGTACTTTGTTGCCAGGATCTGGAGCAATGC
AGCGAGTTTTTCCGCAAGAACCCAAAACTGGGCCTGGAGGAAGCATTCAGCCCTGACCAATTGTTGCAGCGTGCATTTAAATACAAAGTGACACACAACA
GTCTAAAGCAACTGGAGGAAGAGCGACACCTTGAGGTAAAAACTTTGTGGTTCTGAGTGAAGGATCAGATAACTATTGTTTAACATTTAATATGTTTTTC
ACAGTATCTTCGACTTCGCCTGCAGGAAACACCGTTATCGGAAGAGCATCGCATGCTATTCCCTACACTTGAGCACGAGAGCGATGTTGCTGCACAACGA
AAGTCTCTAGAGGTAATCCGGTCGAAGCTACAGCGCTTTGACACGGATGTGGCAAGTGACACGGTTTTCCTTCAACACAAAATTGAGGCGGCCGAGAAAG
CGCAAGCTCAGGCGATGTCTGTTCGCTACGCCATCGCGTACGAGTTGTCAGAAGTTGCGATTGAATTGAACGAGCGAGTTGAGATCAAAAACCGTTTGCG
CTCCAAATTTCGCAAACTTATGGAAACTGCGATCACGGAAGCGACCACATCATCTACAACAAACTCTTCCGCTTCAGGATTCACTATGTGGATCAATCCA
TTCGAGTACATCAACGAACGCATGGCCAGTTGTTTCGAGCGTCTACCTTTGTTGTCAAGCTATATAGACACTGGGGACGAGCTTCATGGGGGCGACAACG
ACACAGATGATGAAGAGAATGAAGAGGCACTACAGAACTTGAAGCACCTCGAGATGTTGGTGCCTCAGTTGGCTGCAGAGTTGCGCTTATTACAACGATC
GTTGGCTTACAACGAACGCTTCCTCCGACCACTTTTACAACGAACTCGACGACTCCAACGTGACACTCAGCTGGCTCGTGTCGAAGTGGAAGAAGCACAA
TTGTTCAAGGACCGATTGGCGGACCAGTTGCTGCAGATTATGTTGACGAGTGAGAAACTCAAGAACGAACGGATGCAGCAGCTCTTTGCTGAAGTTGACA
GTAGCTGACAGCAACGCTAACAGTGTCGATAAACGTGGGAAGTATCTACTGTATTACTACCGGGGTGGAAGCATGCACGCACTAGTGAAAAAGATGAGAG
ACGCCACCCGCTCTTCCTTGGTAGCAAGCGAGCACCTCTCTCCCTTTAAGCATGCTTGGTTCCGTACTGCTGTTTGTGCAGAGGAGGTCACTCACGCGCT
TTATGAGGAGCCTTACTCATCCTCCGTCACGACGTCGGCACCAGCAAACTCAGCCGCCACAGCGGGCTCAGCAGCAACAGGAGGAGCCATGCCGGGGCCC
CACGAAGGAAGCTCA