Description :
From Genome Similarity Track
Location :
Scaffold_33:312571- 314163
Transcript NameFunction/comments
Phyci_156843Hypothetical protein

Sequence
1592 bases(100 bases per row)
TTACATTTTTACGTGTTTTTACAGAGACTATTTATTGGTTTTATAGGcataataattttagtacatgtgcttgtgtgtcacaccaattggtcggaaaggt
cgacggtcggatgttttttggtatggcatacagcagcgatataaccaatcagagcccgcgcggggaggaccttcgtgcaccctaaattagcacatGAGAC
AACGCAGAATATTTTCGGTCTTTATTCAACGCCTAAGTACGGATTCCTATTTTTTACTTAGTCACCTAACCCTCTGTCTTACCTTCATTTTGAGCTACCA
ACCGACCCCATACGACCTGCGTGTCGGGCAGGGTGCCGTTTGGCGCGAAGCGAGCATGCCCAAAATTCAAAGTATGTTTTGTTGCTTTTACGGTGATTAA
GGTGTTTTTTACGCGTAGATTCCGATTCTACACACCATTTGATTGAAAACGAGCTAGGATCACCTCAAAACTAAAATTATGTGCTGAAAAACCACAGTGA
AAAAATCCGTAATGTGGTGCACACATAACACAATTGTGGCGTTACGACTGGAATTGTTTTGCCTTAAACATTTCCGACGAGGAACTAAGGGTCATTTATC
GCGCTTCTCTTCTTTCGTGGCTCAACTGTCTTGGGAACAGGTCGCTTCTTATTCTGCGTGGTCTTCTGGCGGAGAGATCGCTTGGTGGCCGCAATATCAG
CCTGGTCTTCAGCGTCACGAATAATGTAGAGTGGATCGTCGCGTAGGTCTGGTGTACACATTGGATAATTTCCTTGTAGATATCGTGTACTTTTTTTTAT
TGAGAGTAGACTGATCAAGCTTCTCAACGCTAGACCAGAGCTCGCCGACTTCTTCACTGCTGAGTTCTTTGGCAACATCTTGCCTTGCTAATGCCTGCAA
ATCTGGCTCGCTGTTTGGTCGTTTCTGGCATTTGACCACTCCCGGTTCCTCTGTATTCATATCAGTTATCAGGTAGGCCTGAATGCTATGCACCTTTCTA
TATCGTTTTTCTAGCGTCCCTTTGAACTCCTGAAAGGTGTGGTGAGAGCCTTCATGGTTGATGCAGTGATTGCCTGTTGCTGATTTTCTAACCACCCTTT
CAACGTCGTTCATTACCCACTTGTCCCGCTTGGCGTAGTGACGTTTGATGTAGACAAAGTGGCGGTCGTAATGGTTTTTGGTATGCCCCTTGAGAAGAGC
CGCACTCTGGAGGGCGTCGGTGTGAATTAAAACGACCAGGAATTGTAGTGCGTGATTGGTTTTGGCCTGCCCACCGCAATGTCCTAATACGGATGTCAGG
AGAGATTCGCTCCATCACAGTTCGAAACGCAGACAAGGAGGGTTCTTTGATTGTGACGCGCGCGCCCGGTGCCCACTTGATGTACCAATTGTGCATCATA
CTCCACGTGAAGTAGGACGGGAGCAACCGGTACGCCTTTGTTGTATAGTAGCACAGTAGGGCACCCTCCTTCGTCTTCTGGTGCCGAAATCGAACCGCAC
GACTTCACCATTAGTCCAGTAAAGAAGGGTTTCAAAGATTCTACGTCATCATATTTGGCGTTCTTGCTTTCGGCGTTTTCATAGGGTGGGGT