Description :
From Genome Similarity Track
Location :
contig_59:31251- 32663
Sequence
1412 bases(100 bases per row)
GCTTTCGCAAAGTCTAAAAAGGTTGCTAAACCTTCTCGATCCTCCGTGGTCACCAGGTGCTGGAGGTCTCGTACCAGCATCACTTGGTGTTGAATTGAAC
GGCCAGGTATAAATCCTTTTTGGTCTGGGTGCACCAACTGGTTCATGTAGGGACGAAGTCTGTGTGTTATCACACGAGACAGCACCTTTACTTCAACTGG
CATCAGCGATATAGGACGATAGTTCCCTGGGTCAGCTCTATCTCCTTTTTTAAATAGCAAGGCAACCGAAGAATAGCGTTGATGGGGCAATAACTCTCCA
CGCTGCAGCTGGTAACAAAAGACTTCGCGTAAAATTTCTCCAAACGTTTCTGCATCCAGCTGATAAAATGCTGTCGTAAATCCATCAGGACCAGGAGCCG
AGTGGGTTCGCATAGAACGAATTGAAGATGCGAACTCGTCTCTCGTAAAATCTTCTTCAAGGCTTTCCGTTGCATCTGGTGTAAGCTCACGATTAATTGA
TTCCAACAGGCGTTCTTGAGCAACACTGTCAGTTTCTTCATTCTGCAGCGAAAATTGTCGATCAGCAAATATTTCTCCCCAATGTCTTTGAAATCCTGTC
GTGATATCAGCAGGATCAGTCGAGACCGTACCATCCATCTGACGAATGGTACTTAGAGGAGTTTTTCGAAGTTCAAATCGAGGTGCACGAAAGAAAAACT
TTGAACTTTTCTCTCCTTCCGTGACCGTGCGTTCAAATCCAACCCTTTTCCTGAAAGCAGTCCATTCGTCTTGACACTCGTCGAGTCGTTTCTTAGCAAA
ATAGTAGTCAATACTGGCTTGGTCATTTGCGTCTTCCTGCGCTACTGCTTTTGCGCATTCTTCAACGTGATCTCGTGCGATTTCAACATCAGCGTACGTT
GCTGACCGCAAGTTTCGTTGGCACCTTTTCAGGTAACATTTCATCTTCTGCTTCCAGACTTTCCATACTATTCCCGGATTGGCTGACTCTCTTAAAACTG
GAAGAAGCGCTTTTGCCTCAGCAACAATATCCTCACGTAAAATGGGAATATCAAGAAGCCACTCAGGCAACTTCCAGAACCCAGGCCCAGTTGGGTGGTG
CCACGAAGTGAGCTCCACTTGGTGCGCCCGATGGTCGCCATAATCCCAGGTTTCGTAGCTCGCGTCATGATAACACTCCGCCAGTAAGGAATCGGACAGA
AAAATGTAGTCAATACGATTGCGCCGAGGGCGAGGCCCCGAAAAGACCCGATCTTCTGGATGATGAAGACGCCATGCATCAACGACATTAAGCTCCGATA
ACCACGTTAACACTGCCTGCCTGCTATTATCAGGTCTCGGGTGGCTCGATACTGCATCCAGGTCAGGATCAAGTGCTAAGTTGAAGTCTCCACACACGAT
GTGTACAGCATT