Description :
From Genome Similarity Track
Location :
contig_55:312459- 314215
Transcript NameFunction/comments
g10980.t1hypothetical protein
g10981.t1XP_009538945.1 hypothetical protein PHYSODRAFT_348603 [Phytophthora sojae

Sequence
1756 bases(100 bases per row)
GCCAAGATGGAGGAGCTCAGTAGCGCTCTGCGCGAGGCCCAGGAGCGCCAAATGGACCTGGAAACAAGGCAAAACTCCTCTCTGCAGCACGGCCCTGGAT
CGGAAGGCGCACTGGGAGACCAGGGACGCTCGCGCAGTGCTCGCCCGCGTGACCGCGCGTCTTCCTGGAAGCTGTGGACTGCCAACGTGTAGCATTGCGT
CTTCCTAGTGTCTACCTGTCGATACATTTTAGTCGTAAAGTGAGCACCCCCGTCATCATCAAGAGCCACTTCATACACAGCGTCTTAGCCAAAGTCATCG
AGCCAAGAGTACAGTAGCACCAGAACGAGTCGCTCGTTGCCACTGTTCCCGAGTCTAAATCAACGGTCGACCACCGGAGCGGAGCCTACCGTACGTTGAA
GCTGCATGTCAACACGTGGTGGTGGTTTCATTTGCTTTTGCCAGTCGCGCCCTCGCCCAATCTCGACTCGTTTTCCGAGATTCCCTCGCTCTCTTCCTTG
CAGTTTCGTATGGATTTGCCGTGCTGGAGCCTCGGCTGTGGGCTCCAAGTGGGGGGCGATCTTATCGTCGCCACTTGGTTCTCCCTTCAAATGTTGCGGC
AAATGCAACACCTCGAACGTTGTTCGTCATGACTGCACCCCAAAATGTACCGCCGAGGGATCAGTGCCGCGCACTTTGCTTCCTCGTGCAGCGTTGCTCA
GCTGGCGCCGGTGTCTCAACTGCGGCGGTCATGGTGGTCCACCAAATTCCCGCGCATCGCTGGCGCCAGCGACCGGGATCATCGCGTGCACGGTGCAGGC
GGCGAGTTAACTTGCGCCTCACCTATAAACCTCGGAAAGACGAGCCTGCTCGACGTGGCGAAGAGCTCTCTCCGCTCTCCCTGGCGGCTCGCCCAACAGG
CCGGCGCGCGACTCGACGAGCGCAATGCACATGCACATGCGTGTGCATCTCCGCGACTCCGAGAGCCGGCCTCGGACCAGGCCGTCGGCACGGCGCCGCG
TCCTGAAGGTGGCTGCCGCGACTTCGGCCCGCGACCAAGTGGGACGCTTGCCCGAGCCATGATGGTCCTTCCGCTTGAAGGACCGCTGCTCACGCGGCAG
CAGCAGAAGGACCTGTACATGTTCACGGCATCGGTACGAGATCCCACCGCTTTCGCTTGGAGTGGTCCAATGCGCAAGAACTTCAGCATCAGGTTTGCCC
AACTTGGACGGTACCCGCTTCCTCGTCTCGACACCTTTCTTGGCGAAGAACTCTTGCAGCGAGCCAGTCGCTTTGCGCTTAACGTTCGCCACGCGCGACA
TGCGCTGCCGGCACGAGAGGCGGCTGGAGATCAGTGCACACCGCAGCCCTCCACCAAGCAACGCACGACGCGAAGGTCGCAGCATAGAAAGCAAAGGGTC
ATGCCATCGCGGCCCGGACACTGACGGCGCTGCTGTCGCTTGCTCAAGCATGCCCGCCGGATTCTGGCACTACCTGTCACAATTGCAGCGTGTCTTTCTG
ATACAATCGCCGCGCGTGCGCGTACATGACGATCAAGCCATCGTCCGCGTCAACACTCACATGCAGCGATCCTTTCGGCTCCGAGATAACAGCACGCACG
CTCTTCCTAGGCTATCAACGAGTCGGTTCGCAGGACACTTTGATCGTGTTTCATTGCCGTCTATCGGTGTCTTAACTCTATTACTCCTCTCTACTCTTTA
TCTACATTGCATGCAAAATCTGTTGCGTATATAAGTTACGGTCGTCAGCACTCGAC