Description :
From Genome Similarity Track
Location :
contig_55:312440- 313826
Transcript NameFunction/comments
g11502.t1hypothetical protein

Sequence
1386 bases(100 bases per row)
GGCCAAGATGGAGGAGCTCAGTAGCGCTCTGCGCGAGGCCCAGGAGCGCCAAATGGACCTGGAAACAAGGCAAAACTCCTCTCTGCAGCACGGCCCTGGA
TCGGAAGGCGCACTGGGAGACCAGGGACGCTCGCGCAGTGCTCGCCCGCGTGACCGCGCGTCTTCCTGGAAGCTGTGGACTGCCAACGTGTAGCATTGCG
TCTTCCTAGTGTCTACCTGTCGATACATTTTAGTCGTAAAGTGAGCACCCCCGTCATCATCAAGAGCCACTTCATACACAGCGTCTTAGCCAAAGTCATC
GAGCCAAGAGTACAGTAGCACCAGAACGAGTCGCTCGTTGCCACTGTTCCCGAGTCTAAATCAACGGTCGACCACCGGAGCGGAGCCTACCGTACGTTGA
AGCTGCATGTCAACACGTGGTGGTGGTTTCATTTGCTTTTGCCAGTCGCGCCCTCGCCCAATCTCGACTCGTTTTCCGAGATTCCCTCGCTCTCTTCCTT
GCAGTTTCGTATGGATTTGCCGTGCTGGAGCCTCGGCTGTGGGCTCCAAGTGGGGGGCGATCTTATCGTCGCCACTTGGTTCTCCCTTCAAATGTTGCGG
CAAATGCAACACCTCGAACGTTGTTCGTCATGACTGCACCCCAAAATGTACCGCCGAGGGATCAGTGCCGCGCACTTTGCTTCCTCGTGCAGCGTTGCTC
AGCTGGCGCCGGTGTCTCAACTGCGGCGGTCATGGTGGTCCACCAAATTCCCGCGCATCGCTGGCGCCAGCGACCGGGATCATCGCGTGCACGGTGCAGG
CGGCGAGTTAACTTGCGCCTCACCTATAAACCTCGGAAAGACGAGCCTGCTCGACGTGGCGAAGAGCTCTCTCCGCTCTCCCTGGCGGCTCGCCCAACAG
GCCGGCGCGCGACTCGACGAGCGCAATGCACATGCACATGCGTGTGCATCTCCGCGACTCCGAGAGCCGGCCTCGGACCAGGCCGTCGGCACGGCGCCGC
GTCCTGAAGGTGGCTGCCGCGACTTCGGCCCGCGACCAAGTGGGACGCTTGCCCGAGCCATGATGGTCCTTCCGCTTGAAGGACCGCTGCTCACGCGGCA
GCAGCAGAAGGACCTGTACATGTTCACGGCATCGGTACGAGATCCCACCGCTTTCGCTTGGAGTGGTCCAATGCGCAAGAACTTCAGCATCAGGTTTGCC
CAACTTGGACGGTACCCGCTTCCTCGTCTCGACACCTTTCTTGGCGAAGAACTCTTGCAGCGAGCCAGTCGCTTTGCGCTTAACGTTCGCCACGCGCGAC
ATGCGCTGCCGGCACGAGAGGCGGCTGGAGATCAGTGCACACCGCAGCCCTCCACCAAGCAACGCACGACGCGAAGGTCGCAGCAT