Description :
From Genome Similarity Track
Location :
Scaffold_54:31242- 32377
Transcript NameFunction/comments
Phymu_g2862arabinogalactan endo-1,4-beta-galactosidase, putative

Sequence
1135 bases(100 bases per row)
CCCAGCAACATGTTGTTCAAGTCACTGCTCTTCGTCTGTCTCTGCATCGCAAGTGCACTCAGTACTACCGCAGCTCTGACTAAAGGCCACGACTTGTCGT
CCGTCGGGATCATGGAGGCTTCCCAAGGCGCTAAATGGATCTCCACGTCAGGTAAAACTACGACCATCGAATCCATccttggtggtggcggcaTGGAAGC
GGTGCGACTCCGGTACGTTAGTGTACACCTCGTACTACCttttcttcctctgacgctaatCTAAAcgctgcagcctctggacGTCGGGCGACTACAACTT
GACGTACACCTTGAACATGGCCAAGCGGTTCTCCAAAGCGGGATACAAAATCTACCTGGACATGCACTTCTCCGACACGTGGGCCGATCCGACCAAGCAA
GGCACCCCCAAGGCTTGGGACAGCACGTCGATCACCACGCTTTCTACTGCCGTCAAGGCGTACGTGACGTCGACGCTCAAGAGCTTCACAAGTGCCGGAG
TGAACATCGACATCTTGTCGCTGGGCAACGAAGTCACGTATGGAATGCTGTGGCCGACGGGCAAGATATCGAACggcgactacagcaagttCGCTACACT
GTGGAAGGCTGCGCGTCAGGGCGTGACGGCTGCCGTTGCCGCCGGCACTAAGCAGCCGAAGGTCATGATCCATATCGACAACGGGTGGAGGTACAGCTAc
gtctcggccttcttcaagGGCCTCTTTGCGACCGGAACGGTCTCTACTAGCGACGTGGACGTACTCGGCTTCTCGTACTACCCGTTCTACGGCACAGGGG
CTACAATTTCGGCTCTCACGTCGTCGTTGACTCAAATTGCCAACACGTACGGCAAGCCGATCTACATCGCGGAGACCGATTGGCCGACGGAGTGTACGAA
GGTCACGCTGAGTGCTTCCTACCCGGTGAATGCCAAGGGCCAACGCCAGTGGGTGGCTGCTATCATGAGCGTGCTCAACGGCCTCCCAAACAGCTTGGGC
GCTGGCATTTTCTACTGGGAACCCGCGTATCTGTCGGTGGCAGGTCTCGGTAGTTCGTGTGAGTCGGCtctgctcttcagcgtcaacTGGGCCAATTGGC
CGACGACGTACGCCACGGCTCTCTCGTCGGTCTAC