Description :
From Genome Similarity Track
Location :
Scaffold_33:312343- 317428
Transcript NameFunction/comments
Hyaar_Emoy2804951hypothetical protein

Sequence
5085 bases(100 bases per row)
GGCTGGTGAATGTGTCGTACCCAGTAAGCACAATCGTGGATAAAGGAAACAACTGAAAATTTGCCGATCGTCGATGTAGGCGTCTGCAATTATGGGCCAT
TCCTAGATGTTGGCTTCTGACAGCGAGCATAGGCAACACCCAAAAAGCTATGGAAGCAAACGAAAGGATAAGCTGACCATGGCCCCAGTGCACTAGAGAT
GCTACTCCTTGTCGGTATCGAACTCTTGCGACGGTGCTGCATGCATCGCGACTGCATCTGTGCCGTACTGGTAGCTGGTAATTGTACAAATAAGAGCGAA
GAGGTACAGGATCGATCAGATCAAAGAGGAGTAAGAGCCTCCGTAGTACAGTAGCACCTGCCTAGTGTGCTACTGCATCAACTGAGAACCTTCCACTGCC
AAACAATTTCCACTTCGACCACGGAACAAACGCTGCTGCGCTGCGCTGCGAAAGTAGCTTGACCAATAATACTGAGGCCAGATCGTTCAAGCCTTCGATC
CCGGGCTATCGGTTTCATCCGGATTCTACTCGACTGTCCCTGAGAGTAAACATTATACATCAATCAAATGACAGCAATCGAGTACGCAGCGCGCATGGTC
TCGTTCGTAGCTGGGTGTGCTATTCCGACAATTCCGACATCGTTCTAGGTGCCAAATCACGTCTCGTCACCCCAGTTGTACCATTCCGCATTCTAAGACC
TGGTAGACGTTGCACAAAAGTAGAGCAAGCCAAGGAGACAGCACCTTACATATAGTGGATAGGCGATGCATACGTTTCGATCTCGCTACTCATGAATATC
GACAAAAACGATTTACAGGTAGAAGATGAAGGCTTGGCCTGCTCACCGTTTAGTTATAGCCGTTTTGTTGCTATCCTCACATCAACGGGGGTCTGACGGC
GAATGTCCTTCCGCAAATTCAGTCCTCTCGATGAAGGACCGCAGTGTGTGGGAGTCAGTGACGAAAAATCTCGACGCCGGAGGTTAGGGATGTCAGTTAA
AAAGTCCCTGTTTTAATAACATGTTACTTCTTACCAGCATTAAAAGTGTTGGAAACAAGGCCCCATTTTTAAACAGACTTTTTACCAACAAATATTTATT
AACAGTCAAATTATTAATCAAAGAATTAAACATTTGAGGTTGCGCTGCAACCACCCCCACTGTTTGTCGCCCACCCATTACCAGCTAGCACAAAATAGAA
GGAGACTTGGCACCGGCAGGAACCATGGACTTTTCATCTACGCAATCGGTCCTAAAGGCCCACTGTTCCCGCGAAAGGCTTTATATATATGCCTTCTCTG
CAATATTATTAATTTATAACGCATTCCTTGCGATTGCAGTTTTAAAATACCCACCTTCGGACGTCTTCATCTTCTAGTGTGGACGTTCTTTGAAAGGGTG
AAAATGACTGGGGCAAAGTCAAGGCCAAGTGCAACTACTGTTCACTTGGTTTGAAAACAGGTAGTTTGCATTGAGGTTCTCGTTGCGCAGGTATTCCGCG
TTATACTGCTGGTTATTTGCCATCTCTCTACTAAAAGCATGACACAGCCGTGCATATATGCTACTATTGTGGTGAAGTTTAAGGATGAGAACCTTGTCAG
CAACCGGTCGAAAAAAAGTTTCGGTGCGCGCATTGTGTATGAAGATGTCTTTCTCCTATATAATGACTAGCGAATATCCCGGGCACGATTTCTTTATCAC
ATTTTGAGGTTTTTACCCGACCTGGTCACTACATAAAGAGAATTTAATATGTTGAGGTATAAAAGTAGGCAAATGCTAAATGGCTGGGTTCATTTTTATT
CGGCTGCGTCGTGATTCTAGGTCTAGGGTAAAAAAGTCATCGTTTAAAACGCATGTTGTTGAATATCGTCAATTTACCAGATTTTTCAAAAATTGACTTT
TGGTGATCGCTTCGCCAAAGGGGTTTCTCGTGATAGCTATCGTGTTTCAGCTACGATGTACAATTTTTAGAAATTGCGTTTTGTAGTGTTGGTCAGTCGC
TTCACACTAGTTACGAACATGCTTTAAGAGGCACGACAGGGCAGTTAAAACAGCGGCTAACGACTTAGACCCTGTAGGTTTATCAGATACATTCAGCTTC
GGCTATAGAAATCAGCTTGTATGAACTTAAGCGATAAAGAGCAAGAAACCTCGGTTTGTATTTTTACTAATCAAGTACGACCACTAACATCCGCGTTTCA
TTTTACTATGCGAATTGGCTGCTTGCAGACAGCTGCAGCAATTGAACGGTGTTAATATCTCGGTGATACCAATTGCAGTTTAAAGTATGTAAGAGCGCGC
CACTCACAATATTTCTAGGCGAGACATACCGCCTCACCATAAGCGTTCGCGATCGCACGGACGCATCATGTTTGGTGGAACTATTGACTGTGTAGCAATG
ACGGCGTGAAGAAGCGATATATTTTTCGGATTGAAATGCGAACGGCAGAAGAAACGGCTACAATAGGGTATTAGCCTGTTTTGTACCCTTATCGTTATCA
TAAGCTTTAAATGGACATGTGAGTAATAGTGTTAGTAAATTAAGGAATTGGAATCGACGAGGTTAGGAGTGATTCTGAGCTACTTTTGAGTTACTTTTAC
GTTACTCCTGAGGATTAAAAATGACCCAGCCGTTTAGCATTTGTCTAAAAATACCTGTAAGAAAACTGTTAAAAGCTGGTGAAACGATAATAACTGGTGA
TAACGTTAACAGCGGGTAATAAGTGGTAGAAACGTTATGCATTTGGTAAGCAGCGCTAAGAACTGTTAAAAATGACGGAGCTTTTACCGAGCATCCTTAC
CCGCGATTGTACGAACGCGATCAGGTCCGCAGGGATAGTCGTATGAGGATTGCCGTGTGAGGATTGATCCGCGCAATGATACAGTGCTATCTGAAGTTAA
TATGGGGAAAGTCAGCTACCGTGGGTATCCGCTTTTTTTGCGACAATCGACAAAAACCTGTTAAAGTTGCCCTAGAAGACATTATCAGCATATTATGAAG
CTGTGATGTATCCATGCCCAAGTGCTCCTCATATTGAGATCTGCTGGCAGCCCTCCGGACCGTAACAATGCGCATGCTCTGGCCCGTCCTCACCGCTTTC
GGCATCTGTTTCGTACGATGCACTCAAGCGCTGATCGATAACGAACCGGCAAATGTTGCTACTATCGGCACAAGCACGATTCCACGACCTGACAAGAACT
CATCCGATCTGGATAGTTTTGTGGAGTCGTACGGCTCAGCTGTGAACACCTCCGCGTCCGGTGGTCAACGTATGGAGTTGTATGGTCCGATCGTGGAAGA
GACCGGCTGTGGAGACAACGAGCAGGAGCAGCGGTTTGCTCCTATGGACCTTGTGCCATCTTTGCCCGCTTCAGTGGTTCGAGCCAAGAACTTCGTAATG
ACGCGGCTTCACCAAGACCGCGTCAGGATTGACAACAAGCGCCTTAACGATGATTACGATTTCGTAGAAACTGAAGCTATCGAAGACTGGATTGCGTCAG
GCCCCGAAACAGATGAAACGGCAAAGTTATACGCACGTAATAAGATCATAAATGTGTTGACGAAGAACAAACCGCCAGAGGAGGTGGTCGAGACACTGAC
AGCTATTCGAGCAATGGACGAATACCCTCGCGATGTCACCATGCTGTACAGAGCACTAGCTCACCACTATACTAAAACTCCGGATGTGTTGCCCAAAGCG
TGGGTGAAGTTGAAATTCAAACCCGAAGACTTTCTCCGACTCCTCGACTTACTTAACGATGAGGATGATGTGCTTAAAGTAGCAGCCGACGCCGTAATTC
AGTGGATTGAATACACTGAGCTGTTTTAAAAAGAGAACAAGTACTACGCGATGACAGCTGAAGTCGAGGCGAAACTGTTGTTCGATGGCAGACAAAACGA
CCATGTGAACGCCTTAATCGAAACGGTTAAAAAAGCAGAAGGACAGAAAGAATTCGCAAAAATGCTGCGTAAAGATCAACGCGATGTGGCAAAGGAGACG
AACATGCACCGCAAGACCGCTGGACGTAGAGCGGAACGGCGACGAGCGAGGTGGCGTAGCTGGCTACTAAAGAAGATGCTGTTGTTGAAGTAATGAGCGA
GAAATAATTTGATGTTTGACGCAAATCTCGTAGGCCTAGAGTAGCACGAGTAGCACGTAAACTAAGGACCTTCGATACATCGTTTCTTGCGTCATCCACT
TAAGCGTCATTTTAGCGAGTTGTATAAAGCAAGTCATGATTGCGCTAGCGTGCAAGCGTGCGAAAAACCATATTCTTCTAGGCGTGGATCAGCAAACAAA
ATATAAGAAAGGATAAATGCAACGATCACGAAGACCATCTAGCAGAGCTACGGTGATTGGATAATGCTTCAAACGCTCATGTGGTATCCGGATTGCACTA
TCTCATCAAGTATCGGACGCTTTGCTGGAGGTGGCCCACAAAGTGTAAGCGGCGTTCAGATGACGTTCACGACGACGCGAATCGATTATGATATCGTGCA
ATTACAATAGAGTTGGTTCGAAAAACACAACTATGACGTTCGTTAAATACATTCTGCATACCATAAGTGTGGACATACTTTTACGCATAAACAAGATGAA
AGTGAGAGTAAGATAGTAGGGTACTGATGGCGACAGAGGTGCGAAGTGTTATGATCTTCTAGCAAAGAACCAGAAGATCGTAGACGTTGGTAGAAAAGAC
TGCGATATAATAACTGCGATATAATAACATTAGACGTAGGTATGCATTCCTACGATGAAGCTTTTACGGTTGGGTTTAGCGGAAACATGCTACCGCATAA
GGTTTTGAGGGTGGCTCTAAAATATTCAGAAAATATTACACATACCTCTTTTTACTATTAAGATACAGGAGAAAGCTCTGGAGCTCGCCTCCTCATATAA
GTATCCAATTCGAAGAACTGAATCAAGTTGCAAAAGACTATACAACGGCAGACACTGAAGAATGAGTATAGTTCTGTTTATGTCTGTATTGACCCAGTAC
AGTATGGTAGGACAACACGATCGGCCTGTGCTCATGAGCGTCTAGCATTTGCTTATGTGATCATATTCACCTTTGATTGATTTTA