Description :
From Genome Similarity Track
Location :
Scaffold_117:31232- 38308
Transcript NameFunction/comments
Physo_158567hypothetical protein
Physo_158568hypothetical protein

Sequence
7076 bases(100 bases per row)
GTTGGAGGCCGGCTCCAAGGTCGACGATGGCGATCTCGTGGACCCTTGGACGCCTCCGTCCACGCAGATGCAGCTAGCCGTACACCACGACCGATACACC
CAGCTCTTGCGTACATTCCTATCGTGGAAACAGCGCGCTCAAGCGCAGTGTGTGCGGAGAAAAGTGAGGCAAACAGTCAGCAAAAACCTGAATTCACTCA
CGATAACTCTTGACAAAGACTAATAGTGTGAGGGGTTCTGGTATAAATAGCGGATCGCCGCAGCTTGTCGCGTGGGCTCTGTCTTCTACCAGCGGATCTT
CTGGACGCGCTGGCGCGAGTTTGTGGCTGAACGAAAGCAGCAGAGACGAGAAACTCAAGAAAATGAAATGGAGGATCTGGAAGAAGAGGAGGAAGGTGCC
AATAGTGCCGATGTTACCGAGGACACAATAGCAGCAGGTTCTATACCAGATGAAGAAGTAGATTCTCTTGAACAAGGTGCTGGAGTTTTGAGGACGCAGA
TGGAGTACTTCAAGGTGCGAAGAGCTGCCACCTTTTTTCTTCTCCAAAGCAACTAACCAAGTATTTTGTTGTTGTACAGAGGTGGGAACTTGGGGTTGAG
CAGGAGAAGAAGGACACTGCAACCAGCGCTAACTTCATTGTACGCATCCGTTCGTTACACGCTATTCGGCGTTGGCGAGGGTTTGTCCGGAAGAAGAAGG
ATACTGATGTTCTCCAGCAGCGTGCCTACTTCTTCTTGTACTATTGGCTACTCAAGCGCTCATTGGGTCAGCTCGGTCGGCACACGCTGGTCAAAAGGCG
AGAGCGGCAACTGACTTTGAAGATTGCGAAGGCGAATAGAAATCGCTTGCTGGTCAAGAGCATGCAGCGCTGGAGATTGCGTCTACGATTGCATGAAACT
CTAACTCTGTGGAGGGACTATGTGCAGCGGCGGCGGCATCAGAAATCTCTGTACCAACCCATTACCGATGCTCTGACGCGCAAAAGTCACCAGCGCTTGC
TCCAACTTGCATTCGATGTCTGGGCAAAGCAGTGTGCAAGAGCTCAGGGGCAGCGGATGCTAGTTCGTGTTGTTGAGCGCCACATGTACCAAAAAGTGTG
CAAAAGAGCGTGGAGGGCATGGAAAGTGAGAGTCCACCAGCTAGCTCAGCTTGACATTTTCCACCGACGACGCCAGGAGCTTCGGTTGCGACGCGTTTGG
GATGCCTGGAGTGCTCGGACGCGAGAAAAAGAACACCGGGAGCAGCAAAGACGTCGCGCAGTGCGCCACAACTACCTGACGCTGTTACGTATGGGATTTA
AGGGTTTTCGGGCTTGGCGTATTCAAGGAAAACTCAGATTAAGTCGAGTGGAGACTATGCTAGACGCTGCAGACGCTAGCACCATAGCGTCCGCGTTCTC
ACGTTGGGACCATTTCACGAGCAGCAGGAAACTTCAAGCGTTAAAGCGCGACCGTGCTTTACTTCACTCGCAATCACAACTGTTGAAGCGGGTTTGGACG
AAGGGGTTTCTGTGCTTCTTCGCCAGAGCTCAGACAAAGAAGGTGATGGTACTTGCTGCAAGTGAGCAGTACTATAAATGCACAGTGAGACGCTGTTTTC
GTATGTGGAAGGAGATGTGGCAAGCAGAACGAGATCACGAGGTGGCTCTGAGCAATGTGTTACAAGGCTGCATGGCCAAGAAAGCAAAAGCTACCAAAGC
TGCAGTGTTCGAAAACTGGTCGGAGTTCGCTCGCGCGAAAGCTGCTGCACGAGTTGTAAACGCCCAGGTCCGTGGATATGCACAGCGACGCGTGCTTCAA
AAATATTTTTCGCAATGGATCTCGTCTGTTTCCGTACTGCGCTGGCAGCAAATTACGCGTGCACGCGCCGAGCAGCACCACAAAGCCGTAATGCTTAGGA
AATGCTTCGCCCGGTGGCGACACAATGTTTCGGCGCGCCAACGTTACCGCAAAAAGACACGGCATGCGCTTGTCCACTGGAAATTGACGTTGGAACGCAA
AGCGTTCGATGGCTGGAAGCAGTACCTGGAGATGAAGAGAAGTAAGCAACAGCGCATCCACGAAGCTCTCGAGTTTCGACACACACAATTTGTTCGCGAC
GGTCTGCGCCATTGGATGACGACCGCAATGCACTTGCAGGAGCAGCGTGAGCAACGAATGACTGTAGCTCAAGCAAGTAACACGACGGCCGTGTGGCGAC
GAGTTGCAGCAATAGCTCGTCACTGGCGTTACCTTGCGATCCGGCGCAGAGCTCTCAGATGTAAAGGAGAAGTCTCAGTAAACCCGAGGGATGCACCCCG
ACGAATTCCAGACGCACACTCGGCATTCGAACGCGCATCAGCACCACAAGCACACTCCACGCCGACTGTGAAGCTACCGCGAGGAGATGCGGGCGACCGC
GGACATGCAAATGCTGCACACTCAGAAAATTCCAACTGGACAAATGAGCGATCTCCACTTTCCGAGTTCGTCTTGCTTCCAAGAAACCGGCCCCAACCTC
GAAGACCTGTTGAGGTTACGCTCTTTGCCGACGCAAAAGCGGAGAGCTGGCTAGGAGGCAAAGAGAACAGGAAGACGCGCGAAGTCTTACGCTGTGGCTT
TGATTTTCCTGCCGAGAATTTTGTTCCTCTCAGCTTACCACCGGACAATCGAGTTGATCCGCCCAGATCACATAGAAAGCTGCCGGCTACAGCAGCGGCC
ATCGGAGGACAGTGTAAATGCTGCGGAGTGCCGCCTACCTCAGTGGCTCCAGCTATGGAAGGTGATCTGCTCCTACCTAGTACTACACTGGGGCAATTGG
AGACGTTGGAGCAGCAACTACTGGCACTAAGCCGGCGAAAACGAGAGTGGGTGGCGTTTCAACAACAGCTCGACACATTACGTGGAGAAGTAAACACAAA
CCCACGACTTCAGTCGAAGCTTCGATCAATGGAGGAGCAGCACGCGACTCGAACGAAGCAATGGCTTCGCACAAAAGAACGCATTCGTTCACTAGCAGCG
GAGATCCAGTTTTTGAGAAGTGATTTGCAAAGATAATCAACTCGGAGCTTATTGTATTGAGCAACATCGACGGAGTCATCGCAATAACGTTTCATATTCA
TTTATGAGCGTCGTACATTGATCAAAAGCGGCCTCAAAATCACCATCCTCCATTCCATGCTGTCTGTACCAGTGCACGTAAGCACCAGCTTGGAATTGAC
GCTGAGCTCGTTCTAAGAAACGCTTCGTACTCGTCAAGAAGCTACCGTTATTCACGCAAATGGTTGCCGAAGCTTTCGCTTGGAGCGATGAGAAAGGTGC
AGACTTAGAAAACGTTAGCGTGGCTTGTGGTGTTGTCGCTAACCAAGGCACAGGGGGGAACGCAGTCGCAACCATTGCACCAAGCTTTTCTGAAAAGCGA
TCAAGCTCACCGGAGGCGGGATAGAAGCCCCGAAGCAGTGTACTCGATGCCAAAGCTGCGCCAGAAGTACGCGGGAAAGAAGCTACCGTTTGATGCACTA
GCTTCTCGAGCATATCAAGCGACGTGTTGAAGTCAGCAGCGTGCTCATGTCGGAGCGCCAACGAACGCGCTTGTGGAACCACTGGGGCATGAAACAAGGT
CGCTGAATAGACATCTTTCGCCACTGATGCCTTGGAGGGCAGTTTACTGCGTATACCCGACCCAGCACGATCCCTCCACACACCAGATCGGACGTCAAGC
ATCTTCGTTGCAGGCATAGGGCATACATCATGCAGTAACCTGCCGAAGTCAAACGACCGATGCATACCAGAATCGCCCGGTGCTACGGGGAACAAAAGCC
CCGCGAGATCTGCCGCCGCCATGCTGTTCATCTCGACCAGTGATACCCGCTGATTCGAACTATCAGTCCCCACTTTCTCCTGAACTACAGCCTTCCAATA
AGCAGCCGTTCGTAGCAGGTCGTCGTTATCCTTGTAAATAACAGCATCGGCAACCTCTTGCAGACACCGGAGGGTCAACACAGCATTGTAATTCTGGAGA
GGCGAGTCTCCGTGTGTGCACGACGGAGCTACCGATGCAGTCACGATGTAAGCCTTCGGATAGGTGTCCCTCATGCTTTCCAGCACTCGACAGCCCAAGC
CGGACCCAGTACCTCCACCCAGCGAGTGCATGACCACACTGCCTTGGTAGCAGTCCACAGCTTCAATCTCACGTTGCAGAGACTCCATAACCAGCTCCAC
AAGTTCTCGGCGATCATCCACAGCCAGCGACGTAAAGGCCGGAGCCGGGGTTTTCAGCCTTGGTCCGTAGTACCCCATGGCCCAATTGTTGCCTCGACCA
GCTTGCTCCACATGCGTATGAGCCGGCTGGAAGCCTGCAAACACATCCACATCAGCTTCACACACAGCGCGAACCACCTTCGGCTCCGAGTCCACCAGAA
TACAACGCGCAGCGCTACTGGACGGGTGGAACAGGTGTCTGGACAGTAGCGGATCCTTCTTGGGGGCGTTTACAGCGGCGCTGGGGCCTCCTGATCCACG
ACGAAGCCGCCTAGAGCCACCAGCATCGCCTTTGCTACGATTATCTGGCTGAGTATCACTGGAAGCAGCGGCCAGGCGCCAGTACGCGGCGCCGATCTGG
TTGCCGCACTGCCCCACATGCACGTGCACACTCATGCCAGCCTCGAAGCACGTGATTGGTTGACGTCGTGAAGTAACGCTATATTTCGTGCTGGTCCAAC
AGACAACCAAGAGCAAGAAGCGGACCAGTACGATGGCGTCCACAGCGCAGGACGTGGTGCCCTTTGAAGGACGCTTCCCGTCATGGGAGGCCTTCGACGT
GGCCCGGAAGGCCCACTGCGAGAGGACGTACACCATGTACGTGTGTCGCAACACGGTGAAAGTGACGGTGGCCAACAAGCGCCGCAAGCTGCAGGTGCCC
GACAGTTGGGTCTACGACCGCAAGGTGCATCCTTTCAGTCTGTCCATCTACCTGTAAATAGTGTCCACATTGGACTAATTCGTCTTGTTTCAATCGATGT
CTACATGGTAATTGTCCCTGCTGATGCAGATATACGTGTGCACCCATGGCTACAAGCGGGTGTCGCGGTCCGGCGGCTCCCGACCGCGACAGAACGTGCG
CTACACCGACTGCAAGGCTCGCTTCACGGCGTGTGTGGCGAGCGAGCTGGCAGAAGACGGAGGCGAGGCTCTGTTCATCAAGGTCACGGGTCAGCACTTG
GTCCACACCGACCACCCGTTGAGTCTCGAGCAGTGGCGCATGTACTCGCAGAACCGCGCGGCGGTGATCGAGCACCCTTACCTCACACACGAAGCTGATC
TCATGCGCCGGATCGGATCCAACAAGAAAGCCGCACGAGCTCACATCGAGGCGCTGACGGGCAAAGTGTGCACCATGAAGGACATGCACAACCTGTATGC
AAGGCTGAAGAAGCGCGAGAAGAGTCAAAGTCGGCAGCCGCCACAAACGACTGCCAGCAATCCTAGTCCTGGTGCACCGCAGAGCACGACGAAGAATCCA
GGCAGTAGTGTGAGAGGTGCTCGGGTGGAGCCTATTCTACAGAGCTTCGTGGACGCAGACATGGAAAACCACGCGAGCATTTTATCGGCCGACGACGGCT
CCAACGAGGCCATTTGTCTAGCTAGTCGAGCCATGAAGGAGCACTTTCAGGTCTTCCCGGAGCTGCTGATGTTGGATGCGACAACGGCAGCACAGTCGAC
TACACAAGGAGAACAGCACTTGCACGGGTTCTTGTCCATGGATGCGCTGGGCAACTCCAAACCAGTTTTCTTGGCGCGATCGCTGGCCATGTCACCGTCG
CTGTTGCGCCGAGTGTGCCAAGATTTCAAGCGGACACACCCGAAATGGACCCAAACGAAAGTGCTGGTCATGAGCACACTGTTGCGCGACGTTGTCCAAG
TGCTGACACACGAGTTCCCACAGGCGCAATTGCTGCTGTGCCAGTTTCATGTGCTTCAGATTCTCAACGATCTGCTAGCCCAAGCTCACTCGCAGACGTC
GGATCGAAACTTCAGTCCGGACAAAGTGCGCGATTTACTCCAGCAACTCGTATTTGCACACTCCGAGTCCAGATACAACGAGGCGAAGGCGCTGCTAGTG
CGGCACCTGGTTATTGCTGACAAGAGAGAACTACTTGGCCAGTTTGATAAAATGTGGGAGCCATATCGTGCGCTTTGGGTGTCGTACGCGCGCACGGAGC
AGTTCGACTTCTCAAGTTTCCTGACGAAGGGAATTAAGAGCTACTGGGAGCCGATGCAAACTGCATTTAGGCGGACAAGAGATAACGACATTGCGGAACC
AGGAGCCACAAGCGTATCCCACCTCGCCACCGAAGCGATTACATCAGTTGGCCACGCCGTGAGCCCCAAGGACCCGTTCCGGTCTACTGGAAGCATTGTT
GATAGCCAAACCAGTACATCGCTGGCTAGCAATTCATCAACTGTGACTGGGGCACATCGAGGCGTGGAGTCTACAAAAGACACTACTAGCAACCTGCTGG
CCAAATGCACGGCTGAGGTGCTAACCACGATCAATTTTGTTGAAGGCGAGTGGACGTCCAAGATGCTGCTCCTTGAGCTCACCAAGCCCGTTGCTGTGGA
TCGTTACGACCCGCGGTTGCTCTTACTGGTCAACTGCCTCAGCAGCTTCGTCGTGGATGCGATAAGCTCCCAGCTTACTAGCCAAAGCTCAGGCGCTTGC
GGATCCGTGTCCGTCACTAAAACTAGGACGGCTAGAGCTCACGCGGCGAACACCAGATCGGAGTCAAGCGAGTCGCCGGCGTCTCCCAGGTTAACCACCC
CGGAAGCTACGGTGCGGTGGCTGAACAAAACAACGCGCGAGAAGCACATCTTACAGCGCGACGGAAGCGCGTGCGACTGCGCGTTCTTCGCGCTGTACCA
GCTCCCGTGCCGCCATTTGATTTGGTATGAAGTTGTGGCTTTGCAGCACAAGCAGATCAGCCTGACCGCGGTGGGCTCACGGTGGTTTCTACGGTCGTTC
CAGGCGCCGAAGCTGGGAAGGCATCGCGAGTCCAACGAGATCGAGTACCATCTCCTTTAGTTCTCCGAGCAACCTG