Description :
From Genome Similarity Track
Location :
Scaffold_2:31232- 32756
Sequence
1524 bases(100 bases per row)
TATATAAATCAGACCAAGGTCTTAATTAAGAGCTGACTGGATTAAAACCGAGATTATTCACGAGATAATAAGCATGCATTGGCCAAAAAATCTGCAAACG
GCAATACCAGTTTCTTTGCTGTGAAACCATATATTGTGCTTAAAAGGTTTTTTTAGCATTGTAGAGACCTTTTAAAGTACATTACCAAAACCTGTACATG
TAAAATATGTGACTGGTCTGCACGGTACGGATGGTAATAGAGTATGAAAAACCGTAAAATCCCGATTAGGACGCCCTCGTCGAATATAACCCCCTTGCTC
GGAGCATTGTATAAAAATAGAACGCTATCCCTAAACGTTTTATACAAATAATAAAAAGATATGTAACGATTTTTTACTTAAACAAAAGGCAATTTGTTAT
ATTATTATTAGTAATCGTGCTGATACATTATGCAATAGTGTAGATTTTTGTCACAATGTAAATTACGCTTTTGTCCTCAGCTGACACCTCAGAACCATGT
CGTTGTTTTTTTACAGTGAAATCAGTACCATAAACAAAAGAATCTCGAATCAAATACACGAAGATCCTCGATGAAGTCCATGAACAGTAATTGGGCTCTA
TAGTTATTTACTACGGCTATTTGGGGATTTTTCCTGGTATTTGTTATAATTACAGGGCAATATGTGGTAAGATATACTAATTTTAAGAAATTAGTATACA
ATGATTACTATTTTTCATTATCGTTTATTATCAAACTGACCGTAGTAAAGCAAACAGCATTGCCTATCATAGGACTTTTAAGCTCATTTAAAAATGCAGC
AAGAATCCTAGAACTCAATGTCACTACAAATTGATTGTTGTATGTAAGTAATGTATTACGTTTTCTCGTTGCCACACATTTTGCTGTCGCTAGATTCAAC
TTGATTAGTTTAGTATAACGTTTTTAATTGATATTTAGCAAATATTACTGCAAGGTCTTAATTTTGAAAAGTCGAATACAACGCACTGTATAATAATATA
ACCCGCGTACTAATAGGTATTATACGTTAGATTAGGTTTTTCAATAGAACGAGCTGTACCTTCGATTTGAAAATAACGGACCCGATGCGCAATTATTTGA
AAATAACGGGCCGGGCCCGAAACATAATGTCCCCTAAATAACAGTGGAAATAAAATAAAACTCAAATTCATCACTGCCGCACTAAAGGTACAACCATCGA
GGTATCGCTGGCAACAATGATGGTATGGTGTGCTCAAAATTCAGGCTTGACGAGAACGAGCAGTGTGAAGAGGTTTACAATGGAAGCCTTCCAAAACCGT
GTTAAACTTCTGCATAAATGGATATGAGACGTAAATTACGTCTGAGTCACTTCGCCCCCTCATTGTGCAACTACATAAATGTTAACTTGATTAAAGTACA
CACCTCCCTCATTTAGCAACTTGAAGGCATAAAGCCCGACCTCTCACATATATCGACCTCTGCACAGCTTATATTTAGAGATGAATTGAGAGAAACATTT
TATGTCGATGAAATGCAGGTTTTG