Description :
From Genome Similarity Track
Location :
contig_10:312314- 314057
Transcript NameFunction/comments
g2800.t1hypothetical protein AM588_10003735

Sequence
1743 bases(100 bases per row)
TGGGAGGCCAGGCCCCGCAAGTACAAGAGCATTGTTTCGAGTCTCTTCATCCTCATGATGGAGCTGGCCGAGCGTCTCAGCTACTACGGCATCAACCAGG
GCCTCAAGAACTTTATGCAGAAGATCGGCTGGAGTCTCGTCTCGGCCAGCGCCTTGAAGAGCACGTGGACGTCCATCTGCTACCTCACGCCGCTCTTCGG
AGCCTATCTGGCCGACGAGAACGGTGGGGACGCTTCCGCACCATCCTCACATTCGGGATCTGGTACTGCGTGGGCGACTTCATGGTGGCCATCGCTGCGT
ACCCGACCATCATGACCAACTCCGCTGCAGTGAACCCCATCTTCATCATCGGTTTGTTCGTGGGCATCGGCATTGGTACCGGTGCTATCAAGTCCAACGT
CATTACTCTTGGTGCCGACCAGTTTGATCCGCACGACCCGAGCGAGGTGCACCAGAAGGAGACGTACTTCTCGTACTTTTACTTCTGCATCAACGTCGGC
CGGCTTCTCGTACGGCTACCTGTCGATCCTGTGTGTGGATGGCTCGGCTCAGATCCCAGCCGAGTACGGCTACTTCGCGACGTACATGATCTGTGCGGTG
GTGATGATGTTCGCATCATGCGATGCTGTGCGTGGGGTACCCCCGCTACGTGTTCCAGCCGCCTAACGACCGTTCCATCTCGATGCTGTGCCAACTGGGC
TGGGCGAACGCGCACCAGACTCGCAAGGGCCTGGTCCTCGTGGCTAGTTCGTTTAGCTTCCTGGGTGCGCTGGTCATCAACGTCATTGCTGCGTTCACCG
CCTCTTCAGGCAACGTTGGCAACGTTTTATCGTACGTGGCTGCAGTGCTGGTACTTGCCGGTATCGTGGGCTGGGTTACGTCGGCCAAGATCAGTCCTTC
CTGGACGCGTCCAAGAGCAGCATGGGCGGCACTTTCGACGACGAGCGCGTTGAAGGCTACAAGAAGCTGGTGCGTGTGCTGCCCTACGCCGCCTTCACCA
TTATCTGGAACTGCGCCTACGACCAAACCGATGCCAACTTCCAGTCCATCACGCAGCAGTGCGACCTGCGTCTCGACACCAGCGACCCGGACAGCTCTCA
GATCCCTGGCGCCATGCTCGGCGTCTTCCCTATTGTCATTGTGATCTGCATTCCAGTGCTGGACTCCATCGTTTACCCGGCGTACACCAAGTGGGTGGGC
AAGTCCCCCAGTCAGTTCGGCAAGTCCGCGGTGGGACTCGTTGTCGCTATCGTCGGCATCTTCTGGGCTGGCATCTTCGAGGTCATTCGCCGTAACGCCG
GCGCTCTTGAGGACGCAAACGGAGACCCGATCCTGGACGGTGGCAGCTCGCAGCCCATGAACGATATCTTCAGCAGCAGTTCCCAACTACGTCTTCATTG
GTCTGGCTGAATGTCTGATCAACGTACGCCTGCTTGTGTACTCGAGTGTCCCGATGTCGCTGAAGTCCATGGCGCAGGCTGTGATCCTCTTCATGAGCTC
CATGGGAAGCATCCTCACGTCGGTCTTTACCATCATGTTCTCCAAGTCGCTGCCGTCCGACAACCTGAACGAGGACCACCTGGAGAACATGTTCTTCACG
GTGGGCGCTGTCAGCGTCATCAACTTCGTCTTCTTCGTGATCGTCATGAAGAAGATGAACATGGGCATGTCTTCGTCCCCAGAGCTCGACCACCTGGGCA
ACGAGATCCAGGACATCTTGGACGAGAAGGTCTCTGTGAGCTC