Description :
From Genome Similarity Track
Location :
Scaffold_1043:3123- 7954
Transcript NameFunction/comments
g16283.t1hypothetical protein

Sequence
4831 bases(100 bases per row)
ATTCACACGAAGTCGCTGCCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGAC
CAACGCCTTGAATCTCGATCTCGACGTAACCCTTGACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGC
ACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCAT
CGCTGATGAACACGATGCGCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATGTGGCGTGGATGACATGATCTTTGAGTTCGACAATTCGC
AGGCGTGTTCCGTTGCACAACCCCAGGTCGGGATTTAAGTTCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCAC
TGATGTTCAGGGAGTTGAGCACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTGAGTCTGTGGACACATATTCTCGAGCTGGCCCAGTCAT
GCGATCCGCTACGGCTTCGTTGATACGATGGACTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCTGTTGCGACTTCCGAATTG
TTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAATAGCTCCCGGACGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGT
CGATGAGCATGTCGCGTGGAATCTTAATGTAGTCATTTCCCAGATCGTTGTGTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGC
AGCCATTTCTGCAGCACTATCAGAGGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGACGCACCTTCTGGAAAAGTGGCCACAGTTCGGATGACTTC
AGGCATGCGTCGATTGTCTCTGTCGCCGAGCCGCCCTTCACCACGGGGAGAATTTGCCTGAAATCTCCCGAAAGCACAACGACTTTCCCACCGAAAGGTT
CTGCCTCGTTATCCAAAACGTCACGAAGCGTTCTGTCCACTGCCTCAAACGCGTGCCGATGCGCCATGGGTGCCTCGTCCCAAACTATCAAACTTGCTTT
CCTCATCAATTCCGTGACCTGGGATCGCTTGTTGATGTTGCAAGTAGATTCGCCGTCTATCTTCAATGGGATTTTGAAGGTAGAATGCGCTGTCCGACCT
CCCATAAGCAGCAGAGAAGCAATCCCACTGGAAGCGACCGCGATTGCAATTTTTCCGGATAGACGAACCTTGGCCAGTATGTTCCGAAGCAGTGTCGACT
TCCCGGTACCGCCTGGTCCATCAACGAAGAATAGCTTCCTGCCTTCCTGTGGGTCCTCGACAGCTTGGGTGATCTGATCATAGGTCAAGCGCTGCTCCTC
GTTTAGGTGGTCCTCCTCGCTCACAATTTGTTCAAGAACAGACGCGTCATATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAACAGACTCAAGC
ACCAGGCGAGGGAACTCGCTCAGCCGAGGGAGATCAAAGTCTTGGACGGAGTACCCACTGACACTGAGCAAGTCTTGGATACTCTTCAGTGTGTCGAACG
TCACAACAGACGTTTTAAAAGGGTCCAACATCTCTCGGTTCCTGTACGCATAGTCAAGCGAAAGGTCTTTGAAGAATTGGTCCCAAAGACCCCGAACATC
CGTAGGCGCCGAGTAGACCAAGATTGTTGCAAAGAGCTGGCGCAGCTGGTACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAACCCATTCGCTG
TCGTTCTCCAGATAGCCGGCATGTTCAGCCGCGTCTCGATACGTGGGACACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACCTCGGTCCTCGGC
GATGGCATAATAGCAGGCGTAAATAGAAGCGCTCCATATCACGCGGTGAAACATGCACCATCCGACCAATTGCAGCCTGGTACCTTTTACGTCGAACCCA
GCACTTCGTGTTTCCCATCCAGCGGAATTCCTTGGGTATATCCTGGTACAGCATTGTCTTCGCGATCTGGTTCTCGGGTTCGTCGCTCGCACACAATTCG
AAGAAGCGGGTCAACATGGTGTGATTCCCACGACCAGGACACGCTCCGGGTCTTCCGTCGCTCTGAAGAACACGGTTTGGGCATCTTCGACGTGAACGGT
AAGCTGAGTGACTGCGTGTGTCTTTCCTTGGATCAAGAAGTCGAGTAAGCGGATACAGGCTTCAACTGGAGATATGTACCTGGCCGTGAGGAAGCGCAGA
ATCTCGTTTGGCTCTTGCCGAGGGAGCTCTCCACCCGCGCGAACTGCCTCGACAGTTAACACAGCTTTATCGGACCCTTTGTAGACGTACTTGTATAGAT
ATTTCACAGCTGAAATATCCGTGCACACCTCGACGTTGATGTGGCAATTGTACTTTTGGGATAAGTACGGGTTGTACGGAACAACCCACTGGTTAATAGT
GGCGTTGTCGTACTCCCTGCCCTTCCATACCAGGACGCCTTCAGCTCGTCGACGCCGTCTGTAGACCGGATAGCCGTTCACATTGGTCCTTGTCGCCTCT
GCAAAAGGTTTCGGATATCCTTTCGTACACTTCCCGTCCTTCATGCAAGCGCATGACGGGTTTGCCGCTCCACAGGGTCCATGCAGCATGCATGTCATGA
TCGTCTCGAATAGCTGCGGGAACTTTTCTCTGTCAGGAAGCTCTGCAGACACCATACGATCTACGATTTGGCGAGTACGTGGCTTGTCCTCTTCAGCCAA
AATGATCAAGATGTGCGCGTGAGGGAGCCCTCTCTTTTGAAACTCGACCACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTCGCTCAGGTCTTTA
AGCTGAGCTTGCAGTTTTTGCTGCCAGACACGGGCTACAATATCGGGGCGGTCCTGAGCGTTTTGTTGATCGGACCCAAGGGCCTCCACTATCTCTTCCC
ATGTAGGGCTGCAGGTCGTTGTCATGAACACATCAGGCTTGCCGAATTCTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACATCGCTCGAGGACT
GCCCATATGAGATGAGGGCAGAATAACGCGGCGTCCCACTTGGTTGAGAAAATGGGTATCACCACCTCGGCCTCGATCAGGGTGGACCAACGTACCATCG
CCTCTGTCAAACTCGGAGAGTAGCCCTTCGCCTGCTTCCAGCTGAATTGTTCCTTCGTTCAGCAGTGCGTCCTGAAGCCCTCGGTACTGATCGGCGCGAA
TTTGCTTCTGATGTGAGGCCACCCAGCGAAGTTGCTCCTGCTCGCATTTAGCGCGTTGGTCGACACACCACTGCTGAAAGAGACGGCCGCCTTGATGAAG
AGCAGACTGATCTCCCACTTTTTGGTGCAACCGGAAGGCGACATGTTCGCGAAGGGACATCTGGTTCTTGTTGCGACGTCTGACTCCGTTCGCGTATGTG
TCCGTGTAGGTCCAACCCAGCTCCCCATATGGAAGCAGAAGAGGATACTGAAGCGGATCATACTCCGGGCGCGTCTCGAACAGTCGCAGAAGCCTGTGAT
CCCGAGTATACAGTAGTAGATCGCGAGGCCTATCCAGGTTGCCGTCCTCGATGAGCGTCGCGCCTACCTCAGAAACGGTTGGCAAATTGTATGTCCGAGG
ATGCGCTATATTTTCGTGGAGGCGGAACACCATATCCACGACGTCGCTCGTGTCTCGCGAGCGCACTTGCTCTCCGAAACTCAGGAACTGCTGAGCAAAT
GGGTTGTGCTGCTCCATCATTTGCTCAATGTCCATCAACGCCACAGGATCCAAGTCAGCAAAAATTCCTCTGCGGCGTTGGGCGCGCTGCTGCATGTCCG
GGTCCACAATATAGATCTGCGCGAACTTAGGGTCCGTGCGCTCTCCGGTGGCGGGATCAATATAGGGGAGTAGAGATCCCAAGTAGTGACCCATTGCACC
CTGGATGCGGTACGTGTACACGCCCCTCTGTCCCGCTACGCTTGCATCCTGGTTGACGTCCTGGAAGGATCGGTTGGAGCACGAAGCACCAATGGACGTG
AACGCAAAAGCTTGGTTATACGCTCGTATGTGCTGTCGAAACGCTGGATCCCGGTACAGTTGCAACAATCTTGGAGGTGCAGGCCGTAAAGGGGGAAGAC
GAACCTTGTCTTCCAGACAACAGCTCATTTTGGATTCGCCAGGCCACTTCCAAGCGCCACAATGTTCACAAACAGTGGTGGGAGGAAGCCGATGGCGCCC
ATTCACAACGTCTGGACCCTGGACGTAGGCCACGTCAAAATCGTCGTGGTTTGCCAACGCCTCTCCACGTCGAGCCGATCTACGCCGAAATCGCTCTCTC
TCGCGTTGCTCCAGTGCTTCTTCCTCAGTCTGTTCTCTGCGGCGTTCCGCATGTTGCTCTTGGTTTACCCTTCGCGCTTCGGCGCGTTCCTCCTGCGTAA
GCTGTGATCTGCGCTCCGCGTGTTGCTCTTGGTTTGCCATCCGTTCTTCAGCACGCTGGTCCTGCGTAAGCTGTGATCGGCGCTCCGCGTGTTGCTCTTG
GTTTACCATGCGATCTTCGGCACGCTGCTCCTGCGTAAGCTGTGATCGGCGCTGGGCATGTTGCTCCTGGTTTACTATCCGTTCCTCGGCACGCTCCTCC
TGTGTGAGCTGTGATCGGCGCCGGGCATGTT