Description :
From Genome Similarity Track
Location :
Scaffold_1134:3122- 4932
Sequence
1810 bases(100 bases per row)
GTGGCTCGAGCTTGGCGGGTGGGTCCGCGCCTAGCTTCGTCCGCCATAGATCAACTTCTTCCTTGGTCGCATCTCGCAGCGCATCCTTAGATTCGTGTGG
AAACCCGGCCTTGACAGCGTCGTCCAACATTACGTTCGGTCCATTATTTCATCCAGGTTGGTCGCGCCCACGATGTCATCCTCCGTTATACCATCCTCAT
CATCCTCGGGGGCACGTTTGGCTGCGAGGCGCTCCAGGAGATGGTTCACGTTGATCCCAAGTGACTTCAGAGTTCGATCACCAAGTAAGAACTCATCCGC
ATCTCCATCGATCACTACACACTGTAGTCTGCGCAGATTAACCGCACCGGCAGCCGTTAATAGCTGCACGTCAACTTCACACATCTCGGTGCAAGGCACG
AGCCGTCCATCTGCCACTTCAACCTCCATCGGCACTTTCAGCTCTTCCACCACGAGGTCATCATCCAGTTTCCTCAGTTCATGCGCAATGTGGCGGGTAA
TCACGTCGTAGCCAGCGCCAGTGTCGGCTCGGAAAGGCACCTCCAATATGCCATTCAAAATGGCTGCACGCTCGCCGGGCTGCCCAATTGAGTCTTCGCA
CGCAAGCGCTGGTTCTTCATGTCATTCATTCGTTTTAGGGCTGCTTCTTTGTCTGCCTCACTAATATTCTCCAATGCACACGAGACAGCCATCGCGCGGT
GGTGCGCGGGGCTTGTCGGCTTCTTGCTTCGACTGCTTGGGCTTGCTTGATGACGAGTGCTGGGGCTGTGAAACACGAGGCTTCAGCGAAAGTGCTGGCT
TTTTGTTGGAGTGATTGGTCTTGGGGTTGCTACGAGGTTTATCCACCTGCTTGAGCTCCTGGGCCAGCATGTGGTAGTGCCGCTGCTCTCGTGCGCGCTC
CACTAAGGCCTCGTTGAGCGCAACATCATCCTTCTTGAGCACCGGCTTGGCGATGACCAGGCGCTCCATCTCCAGCCTCAACATCTCTGGCGCAATGTTC
TTTAGCAGGTACTTGCAACGCAACTTCATTCGTTCGTCGTAATTCGGTTCATTTTCGCGTCCACTACCGAGGATTCCACCCAAACCATGGTTCTCCACAA
TCTTGTCAAACAGCACGAAGTAATTCACCATACGAGCTTCGGTGTCTTCAATTTTAAGGTCCATCTTCAGTTCGTCCTTGAAAAGCTGGTCCATGTCCGG
GGTGTGGCTGTTTTGCAGCGCTGAGCAACGCCGCGTGATCTCCAGGCCGCGATTTTCATCGGTCACGTCAGCCGCTCGCTTCTTCAGCACGAAGCGAACC
AGGTGGTCCAGGATGCGCGGCTCGATCGAGTTGCGGATCGAGGTGACAACGTGCTCGTACTGCTCGCCAGTAACCGCGCAGCGATTGCGAATCTTGGCTT
CGTACTGGCGGCGCTGCCGCACCCAGGAGATTAGGGACGCCTGGTCCCAGGCACTCAGGCTCGGAGGCTGACCCACCTCGAACACTGGCTGCGGCACGGT
CATCTCGACGTCTCCGTCCGCGTCCGTGACCATCTTGCTTGTCTAGGCTTCACGCCGTGCAGGTCGACTTGATGCTGTAGCGGTCTCCCCGCTTCTTCCT
CTTGCCGCGGCTTCTGGTTCGTCCAGAAAGTATACTTTGTGGTCACCAGTATGCAAAGGAAAGTAAAATGAATTCTGATGTTAGCTCCAACTCTAAACTA
GTGCTTGTTCCTGCTCCTGGCTTTTGTCTACGAATTCGTACAGCTTCTCGAATCCGGTTTCTAGAACTCTAATCACCAGAGCTAGCTTTGCTTCGGATCG
TACAACATGC