Description :
From Genome Similarity Track
Location :
Scaffold_862:3121- 5823
Sequence
2702 bases(100 bases per row)
TTTTTGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGAC
GCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGC
CTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGCCTCCAAGAGGCCCCTGTCCTGGCCCTGC
CGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACACGAACGAGTCAT
CTCGTTCTAGTCCAGGCAGCTCAAAGTCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTT
CACCTTCTGGGCTCTAGACCATTTGTAATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGAATGGCGAGGTGGC
TGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGC
CCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGA
GCGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGCTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTG
GTCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGCTCGACATCCTCGCGGAGGCGCATGACGCGCACTCCAGCGGCCACTTGGGCCGCGAGAA
GACCTTTCTGTCGGACTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCC
GCAGGGCACTCTTCGGCTCCACTACAGAGTTTGCCCGTACCGGCTGGTTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTTCCGCCGACGGAC
ACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTTATGGGGGAACAAACCGCCAGGTT
GTTCGTCGATGGCGTGTTCCGCTATCACGATCTCCCAGAGACGATTGTCTCGGACCGAGACCCACGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCT
TTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCCCAGACAGACGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGA
GTGCGCGGCAGCGCCACGTACGTAGTCGACGCAGCTCCCAGTTGTTGAGTTTGCGCTCAACCACGCGGTGCACGCATCCACGGGTTCACGGCGCTCTACT
GAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAG
GTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGG
CCCAAGATAAACAAAAGGAGTACTCAGACAAAACAGGAAGAGGAAACTTAAGTATATTTGAGGTTGGTGACTTAGTGTTGCTAGACACGAGGAACCTACC
TCTAGACACTGTTAGCTCTGTCGGCAGCAACAAACTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGAC
CTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGGCTCGCAGACCCCCCTTGACC
CAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCTACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTAC
GCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAG
GCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCAGATCATGCGAAAGACCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAG
GCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTAGGCGGCAGCATTACCGCCAGTCCCCAGG
CCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCT
CGGGAGGCGCCGAGTACTCGTACGCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGAAGAAGCCCACTTCCACGTGGAGCGGATCCTCCAGGAGC
AA