Description :
From Genome Similarity Track
Location :
Scaffold_119:31209- 32521
Transcript NameFunction/comments
Phyra_84636ubiquitin-specific protease, putative

Sequence
1312 bases(100 bases per row)
TCTGCGCCACAGTCCACTTGTTGGACGACAGGTCCTTGACGTCGATCCAGTTGCCTGCCTTCTGGTTCAAAATGGACCACTTGGAGCCCGACAAGTCCTC
ACTGCCAAGTCTGCGGAAACACAAGTACGTCCGCAACTCCTCTACAGCAACAAAAGCACCACAAAATGTTAGTACTCTCCCAAGAAAATAGCTCTTAAAA
ACTCAACTACTACTAACCCCCGTCCTCCGAGCAGCTCACCAGCGGCTCCTCCAGGTGCTCGAAGCCCTCGGGCACGTCCTTGAGGTCCCGCACCACGCGG
ATCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCCCACCAAATGAGCGCCTCCGGGTCGCGCCGATCGAAGCCCACGTAG
TGCTCGCCCTCGTTCATCCCCAACGCAGCGAGCAGCGGTGCCACGTCGCGGTTCACGGCCAGCAGCGCGCCCGTGGAAGGGATCTCGAAAATCTTGGCAA
TGACGTACTGGAAGATAAGCGTCGTGGTGATGCCTGTGCGGTACGAGCGCAGGTACGACGCGTAAATGGCCGACTGGTTGTCAGCTACGTAATAACCGGA
ATGCTGATACACGTCCATGATGTCCCGATGGTCCTGCTGGTAAATGCCCAGCCAGTGGCGCAGCGGGTACCAGTTGGAGCCAAGCTTGCCCGAAAGGACG
ATCTTGTTGATCGGGTACTCGTTGAACGTAGCGTTCACAAAGTCCGGGCCGGACGAGTGCGGCAGCCAGAGCGTCAGAGGCAAATCGCGCTCGTTCACAG
TGTCAGTGACCT