Description :
From Genome Similarity Track
Location :
contig_55:312083- 313839
Transcript NameFunction/comments
g9297.t1hypothetical protein PHYSODRAFT_348604

Sequence
1756 bases(100 bases per row)
GCTGAGCATGAAGAACCGCCTGAGTCAGTCGCAGCACGTGATCCTGGCCTACGAGGCCAAGATGGAGGAGCTCAGTAGCGCTCTGCGCGAGGCCCAGGAG
CGCCAAATGGACCTGGAAACAAGGCAAAACTCCTCTCTGCAGCACGGCCCTGGATCGGAAGGCGCACTGGGAGACCAGGGACGCTCGCGCAGTGCTCGCC
CGCGTGACCGCGCGTCTTCCTGGAAGCTGTGGACTGCCAACGTGTAGCATTGCGTCTTCCTAGTGTCTACCTGTCGATACATTTTAGTCGTAAAGTGAGC
ACCCCCGTCATCATCAAGAGCCACTTCATACACAGCGTCTTAGCCAAAGTCATCGAGCCAAGAGTACAGTAGCACCAGAACGAGTCGCTCGTTGCCACTG
TTCCCGAGTCTAAATCAACGGTCGACCACCGGAGCGGAGCCTACCGTACGTTGAAGCTGCATGTCAACACGTGGTGGTGGTTTCATTTGCTTTTGCCAGT
CGCGCCCTCGCCCAATCTCGACTCGTTTTCCGAGATTCCCTCGCTCTCTTCCTTGCAGTTTCGTATGGATTTGCCGTGCTGGAGCCTCGGCTGTGGGCTC
CAAGTGGGGGGCGATCTTATCGTCGCCACTTGGTTCTCCCTTCAAATGTTGCGGCAAATGCAACACCTCGAACGTTGTTCGTCATGACTGCACCCCAAAA
TGTACCGCCGAGGGATCAGTGCCGCGCACTTTGCTTCCTCGTGCAGCGTTGCTCAGCTGGCGCCGGTGTCTCAACTGCGGCGGTCATGGTGGTCCACCAA
ATTCCCGCGCATCGCTGGCGCCAGCGACCGGGATCATCGCGTGCACGGTGCAGGCGGCGAGTTAACTTGCGCCTCACCTATAAACCTCGGAAAGACGAGC
CTGCTCGACGTGGCGAAGAGCTCTCTCCGCTCTCCCTGGCGGCTCGCCCAACAGGCCGGCGCGCGACTCGACGAGCGCAATGCACATGCACATGCGTGTG
CATCTCCGCGACTCCGAGAGCCGGCCTCGGACCAGGCCGTCGGCACGGCGCCGCGTCCTGAAGGTGGCTGCCGCGACTTCGGCCCGCGACCAAGTGGGAC
GCTTGCCCGAGCCATGATGGTCCTTCCGCTTGAAGGACCGCTGCTCACGCGGCAGCAGCAGAAGGACCTGTACATGTTCACGGCATCGGTACGAGATCCC
ACCGCTTTCGCTTGGAGTGGTCCAATGCGCAAGAACTTCAGCATCAGGTTTGCCCAACTTGGACGGTACCCGCTTCCTCGTCTCGACACCTTTCTTGGCG
AAGAACTCTTGCAGCGAGCCAGTCGCTTTGCGCTTAACGTTCGCCACGCGCGACATGCGCTGCCGGCACGAGAGGCGGCTGGAGATCAGTGCACACCGCA
GCCCTCCACCAAGCAACGCACGACGCGAAGGTCGCAGCATAGAAAGCAAAGGGTCATGCCATCGCGGCCCGGACACTGACGGCGCTGCTGTCGCTTGCTC
AAGCATGCCCGCCGGATTCTGGCACTACCTGTCACAATTGCAGCGTGTCTTTCTGATACAATCGCCGCGCGTGCGCGTACATGACGATCAAGCCATCGTC
CGCGTCAACACTCACATGCAGCGATCCTTTCGGCTCCGAGATAACAGCACGCACGCTCTTCCTAGGCTATCAACGAGTCGGTTCGCAGGACACTTTGATC
GTGTTTCATTGCCGTCTATCGGTGTCTTAACTCTATTACTCCTCTACTCTTTATCT