Description :
From Genome Similarity Track
Location :
Scaffold_1283:3120- 4288
Sequence
1168 bases(100 bases per row)
GGGGCCTTCTCATCGAACTGCCCTAGCGTGCTGGAGTTGACATACGGGCGGAACGTCCAGGAGGTCTTGCCATCCCCAACCGTAGTTGATCCCACGGTCG
GTGTAGCGTCCTCGTCGTCCAGGCTGTCGTCCGAGTTGGAGCTATCATCATCCGAGCTCGAGGAACTGGAGCTCGAATCCGGGGACGAGTCGCGAACCCG
GCGGCGCCCCTTGCGTGACGCCTTCTTGCGATCGTCCTTCCTGCGTTCGTCCTTCCTGGGCGGGTCCTTCTTTGGCTCCGTTGGCTCCTTCTTCACCGTC
GTTTTGGTCCCTGGACGGGAGGTCCCCGTCGGGGCAACCTGCGTTGCCGTAGTAGATCGGTGTGCCGCATTAACTGCGGCCGGCTCATTTTTCACCACGG
TCGGCCTCAGAGTCCTTGCTAGACGCGCGACGTAGACTCCCGGCAGTGTTGGCAGTAGATGTTCCCAGTCGGCTTCGGTCGTGTTCTTCTGTCCCGGTTG
TGTACCTGCGACCGTTGCGTTTCCCGTGATTACGCCCGTTGCCCGTTCAGGGTTGTCACTTCCCGTTTGTATGGGAGTTGCCCGATTAGGGTCGGATGTT
CCCCGTTCAGGTTGAGCTTGGGCAGATGTTGCTTGAAGGTCGCGTATCTGTCCCACATGGAAACGCTGGATATTCTGAGCAGACTCACGTTCCTGCGCAC
GCGCGACTTCCGACGCCTGCAGCCTGGCTGCCAACGCGGCCAGGTCCTGCTGGGTCTGCCCAGCCCGGGCTGCCATGTCGGCGGCGTGCCTCGCGTCGGC
TTCACCTAGCTGCCGGCGGATATACTCCGCGGCGGTTGCCTCCACACGCTCACGCTCGGCCCGCGCGGCTTCACGACGAGCGGCTTCAACGCTGGCTTCG
GCCGTCAGGAACTGCGAGCCGGCCTGGGGTGCCTGGGCGTAGACCTCATGCAGGCGTCGCTCAAGAAACTGGGCCCGGCGCTAGGCTTCGCGCGCTTCCC
GTTGGGCTTCAGCCAGAGCAAGCTCGGCTTCGGCATCCAGGCTAGGATCCTTCCCGGTCGACACAGCTTCGCGAAGCTTCGACAGCTCGGCACCAAGCTG
CTGGACCTGGTGGAAGGTCGACACCGCCATCTCCGCCATCCCCGACTGGGCCGACAGGCTTGTCCGTC