Description :
From Genome Similarity Track
Location :
Scaffold_24:311980- 323784
Transcript NameFunction/comments
Physo_133104hypothetical protein
Physo_133105hypothetical protein
Physo_133106hypothetical protein

Sequence
11804 bases(100 bases per row)
TTCCGCTTTGTCCGCGAGGTAACGCGCCTCACGAGCGGCGAGCTCGTCTCGGCGGCGCTGCGCTTCCTCCATGCGTCGGGCCTCGGCCTTGCGTTCGTTC
TCCTCGCGCATCATCAGCATCATCTCGAAGAGGTTGCCCCCCATCGTGCTGGCTGAGCTCTCGAGGTCGCTCAGCCGTTTCTTCAGCGCCGTTGTCGCTT
TGGCAGCCCGGGCACGCTTTGCCTTCGCGTAGCTGGCTTCGGTCAGCTCCTCGTACGCACGCTTGCGGCCGACTGTGTCGCGGAAGTCGGCCAGGTTTCC
CCCTCCTAGCCTATTGGAGGAGTTAGCAAGTTTCGGGTAGCGCTGTGCTTCCTGCTGGTCACGCGTGCGAGCGCCCTCTTACGTAGTCGCGCTCGGCGAC
GCCACGGCCGCGGTTGGCGTTGAAGTGACTCGCGAGGCGCTCCCACTTGTCCTGCCCAAGCGGGAGGTACTTGGCGACGAGAACCAGGAGGCGGCGAACC
TCGTTCACCTTGTAGTTAGAGCTTCCAGTAAGTTTAGCCATCTACAGAACCCATACGAGCGTGTGAGTGTAACGACGTAGTCAATGCATGCAAAGCAGCA
TTAGCAGCGTACCGGGAACGGCGGTGGAGGGCTTGGGGGTGGGGAGTAGTTGTGCTCGAAGCGGAGGACTTGGGCGGTGCTTGGAAAAAGCAGGAATGAC
ATCGCAAGGGGCCACTGCACTGTCAGCGGCCGCCTCAGCAACACCACAGCTAATTGCCCCTCAACGCACCACCACCAATGAAGCGCCAACAGAGTGCGCG
AGTTCGCGCTCAAACCGCGCGCGCGCGATGACCACGGCAGACTCACGTCCAGGCCACCGTTCGTTTTGGCGCCAAACAAGGCTCTAGGCAATCGACGTTG
AAGACAAAAGTTCCATTTTCTAGCAATAACAGTCAACTTCAACATCAAACATGCTTGTCAGATTCAGATTCATGGATTTCTTGCAAATGCTTATCACAGT
ACGCTTGCCTATGCAACACATCACTCCTCATCGCTTGCTACACCTTCTCTGCATTCAGTTCTCACCTACGGGTCGCGCTGGTCCTGGATCGCGCGGTGGT
GGCACGATTCGCTGCCGCAGCGGCAGACAAACCACAAGTCGGCCCCGTAGTCAACCGTGATCACTTGTCCTTGGAGCACGTCTTCTGTCGTAGCCACCAC
GACCGTCGTTCGCCGCCCATTTGCCACCTCGTGGAACGTAGCCACCGGCTCGCACGAGTGGTTAACAAAGCGCATCAGTCCCCCAAGGTGCTGGGCGTTG
ATTGCAACGCGGACGGGGTAGCTGGGCGTCTCTGGTCTCTGCCTCATGACGAGGCCATAGCCCTCGTTGCGCGGACGGTTCTCGGGCGCGACACTCACGT
GCTCGAGCTCGCCCAAGTACTGGCCCAACACCTCGCCGCTCTCAATGTCGTCGGTGGCCACCACAGACAGCTGCCGCGTTCGCGCGTTCCTCGCCAAGCG
GGTCTTCGTCGACTCCAACAGTCCGTTCCCGCACATGCCCTCGTACGGACAGCAGTTCCGATTGCAGTACAACTGCATCAACGAGTTGCGGCAGCTCCCC
ACTCGGCACGAAGACGAGCAGTCACACCAGTCGAAGTGGGGCACTGCAGGGAAGACCGTGCCGAGCGGGTTGAATTGCTCACGGAGGTGAGCCACGCGAA
ATGGCCGCTGCGCCGGGACGAATCGGTCGCGTGGACGGGGGACACGAGGCTCCGCGCGAACAGCAGAGGCTGGACTCGTCCGCATCAGGCCGCTCGGGTT
CACCGTCGGCGAAGCCGGCGGCTGCAGTTGTTCACGGCGGCGTGCGTACGGACCAGCATCAGCTCGGCGCTCCTGGCAGGCGCTTCGACGCTCTCGACGC
GGGGGCCTTGGTCGTGTGCGTGGCGGGGGTGGCGACGGCGGCGTCTCCATCAGGACCTGAGATGACGTCGTGGGGCGCACGGGTTTCGCATGGGCAGCGG
CGTCGACGAGGTGGCGTCCGTCGTCGTCTCGGGCGGCGCTGGGTTCGTGTCCGCGTTCGGCACGCGGAGGCCATGCTGCGGGGCCACCCACGGCGGAGTC
GCGGTCTCCGTCGAGCTGTCGCTCTCCGCAGGCGTCGTCTTCTTTGCGCTGGGCCGGTGCTTGCTGCCGCTCGCCGCGGACGCCGCCTTGGTCTACCACG
TTCGGCGGGGTGTTCTCCTCGTCGCTCGAGTCCTGGATGCAGCGGACGGGCCAGTAGGTAGTTGAGCGGACCATAGTTACTAGCAGTAGAGAAAGTAGTT
AGTATAACTGAACAAATGCACGCATGCGTGCACAGGCGCGTACCTTTTGGTTGCAGGGGCAACGCGGCTTGTTCCTCAGCTGACGATTTTCGAAAGTGAG
CAGCCGAAGGGGAGGGACGCAACTTGAGATATGCTACGATATATGACTGCTTCAACAGCTAGAGTGGATGGTCGGCATAGACTATACAAACTTCAAGATC
AACGATTAAGATGGGTTCACTGCATAAGTCTAGGGGTAGGGCTGTTTATTGAGACGATTTTTACGCCTCACGAAATTTATTTTGCGTTATGCCCCGCCAT
ATCTGCTGCGTCCACTGGTACAGTAGTATATGTGCAAGGTCAATGCTGCCCCCGTTCATCTGAAAGGAACTTGGCAAGGGTGACCCCACTCTCCTTTTTG
CGGTGTCAAGTCCACGCGTCATAGCTTAAGATGGCATGGTTGAAGGTGCTTGCGGCCAGTATCGCAATAGCTACCAGCACGCTAAGCTCGACCGGTGTCA
TCATTACGAAGAATAGCACATCCCGACCTATAACCACGACGCGTAAGCACTCCGTGGCGGCATCAGCCTCCGGGTCCGTTGCCAATTTGATCGAGGAACT
GTTCTCCTCGGCCTCTGCATCGCGTTCCGGCTCCGTGTCTTTTGCTGAAGCGTTCACTGTGTTTTCTTCCTCTGGATCGGGATCAGCGCAGTCCTCAGGC
TCATCATCGCCACCCGTGTCATCGGTGGAGGACGTATCGGTCACAGTGACGTCGGGTTCGTCGGCGAAATCTTCAGCGCTGGTCACGATTGGATCTGTCG
CAGGGGTCGGAAAAAATAATAGCAAAACAATTATTATGGTATTGTCCCACTGCAATTATTTATTATTGGAAGTTCATGAAACCAATACAATATGATATTG
CCCCAATAATAGCAATACAATATCAAATACTATGAATTCTGGGGTTGGGCGTTCATAAATGTTGAAAATGCTATAGTAAACTATTATAATCTCTATTTTT
CGGGTCGAGGACACAGCCTTGGGTTGCGAGGCTTTTGTGGAGCAAGCGGTGTATACTCAATAGCGCTTTGCCGGACAGCAACACTTCCCAAAACCGTCCT
GGAAACAGTACAGGGCTATTGTAATCGTCATCAGCCTCCACCTGTATTTTCTCACTGAATAGGTTGGCCTGACACCTCAGTAATAGTTCGATATCAGCCA
TGGGACGTTTGCGTAAAGTTCGCGTGAAGTTTACGCAAACGTCCTATGGCTGATATCGAACGGCCTTCCTGTCACATTTTGGCAATGAATAGCTCATGAA
TAGCTCATGTCACGAATGGTACAATATACTTAAATTGTACCAATTATTATTATTGGTTGACCTCATATTGCCGTTATTACTACTGCAGCTTTGGCCTCGC
AATACAATTTTATACTGTATTATCCGACCCCTGATCTGTCGGCTCATACGATATAGCGACACCACTCACAGCCAAGAGCTCCGCTGTGCCAGTCTACCGT
AACTGGGTGGGTCCACGCTCCACGCTCGGTCCAGAGTGGCGCTGCGTGCTGGCGTGAGGCACACATTATGAAGAAGTGTCCGAAGGGCTACGTCCGCAGC
GAGAAGACCAGCACGTGCTGGGCCGAGTGCCCCATTGAGTTCCCAGTGGAGTGCGGCATGGAGTGCATCCGCCAGAACGACGACTGTGGGCGCGAAGTGC
TCTACAAGGTCGGCTCTGTATTCAACGTCGGTATCAACGGCGTCATAGACAACTGGTTCGGCAAGTTCTCCGAGATGGCCAAGGGCGTACGAACTGCCGT
CATGTGCTCCTGTATGATCGTGGGCGAGCTGCGAGCGCTCAACCTCTACATCCGCTCCATTAAGGCTGCCGATCCCGAGGCGTCTCAAGATAAAATTCTG
GCGATGCTCTACCAGTCGAACGCCGTCGTCGTCGAGTTGCCCATTACCATCAAGTTGTGTCTGGGCGGCAAGGCAACTTGCAACAGGTGGCTTGCAGACA
GAATCATGTCCACGACGCAGTACATTTTGGCGCAAGTACTTGCCCACGACGACAGCATCATCGCCAGCTGGCAGCGGTTCAAGGCCTTCATGAAGGGAGC
CAACTTCACGGCCCCGCCCGAGCAGGTTACCCAAGGCGAGATCGGGTACCTCAAGGACGCTCTCAGGTCGAATTCGACGTGTGGTCACGACCTGCAAGGC
TTCATGGAGCGCACGTGGTCGACTGCCGAGGCCTTGAGGGAGCCGAACCCCGACATCACAGAGGACGAGCTGCGCGTGAAGATCCAGGACACGGACATCT
TCAAGTCGGACATAGCGACGGTGACGAGCAACTGTATGGAGCTGCTGATCTCCCAGTCCGACGAGAAGACGGCCTACAAAACACGGTAGAAGCTGCGCAA
GACGTTCGGCGTGGTCATCAATGACCTCATCACGACAGGGAAGAGTGACAACGGCACGTCCTACAAGGCCATGGAGTACGCGTACCAGGTTGTGAACCAG
GGTCTTAACTTCTGGGTCGTCACGGGCTTCGACATGAGCGGCGTCTCGAGTTTCATCTCCGAGTACTTCCAGTCCATCTGCGGCCCCACGCAGTTCATGG
GCGAGCGACGACGGCACCCACCCGGACACGCTGGGCCTCAACATGATCCAGAAGGCTTTCAAGAACACCACCATGTCATGGCCAAAGAAGGGCGGCGGTC
AGGTGATCCACAACTTCACGAGCACCGACACCAAGAACGTGACGGTGAACATCATATCTGGAGGTGACAAGATCGACGAGATCGACGTTGTTGCCGGTGG
GACCGCGACGTGTAAATCGACCGTGGAGAAGCTGGGCGGTCGGACCCTGTATCTGGATCGCTGGCGCCCCGGTTTCTTTGGTCTTCCTGGCACCGGAGGG
GGTTAGTTGATGCTGTGGGTACCTCGCGCAGCAGAAGGGGGCCATTTGGACCTGGACGTGAGGCTGAATGTGAGTTAGTTAGTTGGTTCGTATCGGTAGT
TAGTTAATCAGCGAATTTAGTGGAAACTCTGAGTGAAGCGTCAACTTATGAACCGCAAAAAAGCAGTAAAAAAAATACAAGTCAATCTTTCTGATCTTGA
CGAGAATGCGACTGAATTGACCTGAGAAAACGTAAGTCTTGGACGCAGACGCTTGGAGAGTTCGCTCTTATTGATAAAATTTGTGAATTGTCTGCTATCG
ACGGATCACAAAGCAAAGCAATATGCTGGGAAGCCGAACAGAGCTTCTGTGTCCTCGTAAGTGTTGGACGTATGTAAGCTATTAGCGCGCTGTGTATTGT
GTACTAATTCATCTCTCACGCGTGTTTTGTCGTGGCTTGGTGTGCTGCCGACTTCGTGAAGGCCCGTGAGGGTGAACGTCGCTGTTGCTGGTAGCGAAGC
TGACAGCGTCGCTGCCACAAGTGATCTCGCTGTTGCTGGCGGGGTCGCTATCGCTTGTGGTGCCGTCGCACCTCGTCGCGAAGATGTCGACGCTGGAGTC
GCCGTTGCCGCTGGAGTCGTCGATGCCGCTGGAGTCGCCGTTGCCGCTGGAGTCGCCGATGCTGCAGGTGTCAAAGCTGGCGGCGGGGCGACATCTGAAG
CTTGTGTTGGCGACGAAGGTGTTGCTGCTGCCGGCGTTGATGTCGCGGGCGGCGTCGATGTTGCTGATGGCGCCGCCGACTGGAGCGTGACTGCTGAAAG
TTCGAGTGGACCATGAGCTGGGCTATTCTCCACAGCGACTTGACGCTTCCGCCGCTTGAATGGAAGCGACCGCGTGCCTGTGCCTTCAGCTTCGCGAATT
AATCTCAGCACCGTGGTAAGCTTGAGCTGATTGGTTCTGCGCTTACGCTTACTCGGCTTTAATTGAAGTTTGTGATAGCCAATGTTGAACAGCTCGATGG
CGTGAGGTTCGTCCCGAATTGGAGGTAGTGACATGCCTGCTTGTGCTTCAACTGCGTTACTTATGTGCCTCATCATGATAGACCACTCCGCCAAAGTCGC
TTTCTTCTTTGGCGTGTCGAGATCGTCCGAGGAAATAGCTTTGTACGGAGGATAGCCACGTCTCGCATCGCCAAACCACCACAATATCCACGCGCCGAGT
GGATCAATACTGGGAAATTCAAATTCTTTCGGCAGCCTATGAAACTTACCACCCCATGAGTAGTAGGTGTGCGTTGGACCAGAAGAGGCTGGTGTTGGTT
CTGTAGAGCTAGTGCGACGAAGCCCCACCTCCAGCAAGAGCGCTTTAATTTCTTGGCGTAAACGTTTCCGAGTAATATTACCCGCGGCAACATCTTTTTC
CTCGAGCACCTTTTCCATTCGCTGTTCAAGCATTTCGGGGAGAGCATCTATAGACTGTTGCTGTTTGTCGAGCTTCTTGTACAGCTCAATATGAGGCGGT
ATCCCCGACGGCTCCATCCATCTCGACTCTCCGACCTCCAGTTTCGAACGCAGATTGTTGAGAACGGTAGGGTTTGTGAACACAAACGTCGACAGAAGGG
GGTGGTTGGTAGGCAAGTGGTTCACTAAAAAATCAGCGTGCTGGACAAGCGAAGCAAGACACAGCCTCAAAATATCACTTAGGGGCAATTCGTCGACGAG
TCCTGGAAACATCGCTGCAAGACACGACTTTATCTCGTCGTCCGAGTTATTGCGGAAGTGCGGTGGTAGGATGGCGAACTTGGAGTCATTCACAGGAAGC
CCAGCAACAACACGCCCTAAAAATTGATCGCCCGCAGCTTCATATCGAAAGTATCTGTCTTGCACTCCGCCCATAGACCACCCACACCGAAGACAAACAC
TTACAATGGACGGGCCACCAGTACTTCCTCCGCAGGCAAATGTTGCCACACCTTTCCTCACCGAGTGCGTGCCGTAGGTTTTAGCCACTCCATCTTTTTT
CAGGAGATTTCCTAATGTCTTGCCGAAGCGAAGCTTTGGGTCAGAGCCCAGAAATAGTGGCCCTGGTTGCGTGCGCGGATTACATGCCCAATAAATCGCC
AACGCTGTCACCCAACACGTAGATGGCGAAAACGGGTTTGCGAAAAGATGACGGGGGTCACGTGGCCCAGCACCTTCCTGATTGGTCTTGGACTTAAAAA
ATATCGCCCCAACAGCATCATCTTTGGCCAAAAAGTGCTGCGTCTGCAGGGTTTGAACATAAACTGATCGACACATGAGATTCCACTGAGTAGTTAAAAA
GAGATGCGAGAACCCCCCATCGTTGCGCTCAAGAGTAGACCAACACAGCTCCTTGTACAACGTAAAAGTCAGCGGCTGCTTGCCCGAGTGTTTAGGAGAG
CTAGACTGGTTTTGCTCGGCCTCGAGTCGCTTGCACCTAGAAAAAAACTGCTTCATGTCATCTCCGTATTCCACAGGCAGCGCTGCTCGTTTCAATCGAT
ACAGATCCTTTATCGCGCTGCGATAGCCGCTTAGCGTCGCCGATTTGACTGTACTTCGTTTGTACACCAAAAATTGCTCGAAGCAAGCTGGAGTGAACTC
TGTGAGGTTTAGATCATCATCGGCATCGAAGAATTTAGCTGTATTGCGATCCTCCAGCGTCAGCGCATACACTTCTCTGATCCACTTCTTGATGCCGTTG
ATATTGCTGGTGTACTTCTTTCTCGTCTCTTTGGAGATGCATGCGTCGCGTATTGCCTTCACCTCCGCGACAGCGTCCTGCGAGCTTCCATCGGCCATCT
TCGCACGAAGCGTTAGTTCTTAAAGTGATTTTGGCCAATCATCGTGGCGCCTTATCGTCGGCTACCGCCGCTTACGCCTTCCCGTAAGGATGCGATCCTA
ACTGCCCCTATAGTGGACCTCAGTCAATGTGTCGTCCTCCAAGGGGTGGGAATACACCAATTCCGGAAATCATAAGCCAATCCGCCTACGTTTTAACAGG
CAATCCCATATGTAACTTACGTAAATACGAGAATGAGTAATGAATAGCCGATATGAAAGTAAGAACGTGAGTAGGGTGCTATTTCGGATATCAAGACAAA
TTAATTGGCCCATGTGATTGATTGGCTTAATGATTTCTCACATGTTTTGATTTTAAGTAGCTATTTGGGGTGATCCACACAACCTGATACATCGTGTACT
TACAATTTGTAAATTAGCTTCGTTCTTACTTTACTGAATAGTTATCGGAAGGTCCGCCACTGAGCGCAGATATCAGCCAGGTCCATCGTCTGGGGCCGAA
GCCCAACCCCAAGGAAGCGGGACTCGCATCCAAAGACGCCTCCGTGACTGCCGAGCAAAGGCCCACAAACAGTGGATCCACAAACGGGTCAAGTCCAACT
TGCTGCTCCTTGGTCGTATTGGATCGGAAACAACGCGCCTCATTCACCTTGAAACACTTGTCTGGAAACGACTGCAGGCCAGCTTGTTCAACACGAGCTC
GACATTAATCGCTTCTTGTCGAGAGTTCATTACATCCATTCGAGAGATGCAGCTTGGGGTCTGAAAGTGATGTCTGAGCCTCCCAAGATGAGTCTGACAT
AAAAATCTGGTACGCCACACCAAAAGCGTGCAGTCTACAATTCCAGTGAATAGAAGTCGCGGCGTTGCCATACACTTCGCTACAGTAGACGCTGTCAACG
CGATCACCTAGCTGTATCTCGAAACTCAGGCGAATATTTCCACGGGTTATACGGGAATGCGAGCAAATCTCCCCACGGACTGCTGCGGGTTCATGACAGC
GGAGATACAAACTGGAGGTCCCAGTCTGGGAATATTTTTTGGGCTGTTGAAGACGCATGTCTGTCAGCGCCTCATTGTTCACAAGCGAAAGTAGTGTGGG
TAACTCTATGGCCTTTCGAGTTCGCATCTGTCGTGCTGGATCTTGTTGCCTGCATTTTGTGGGCGCGCAAAATAGCCTGTCAAGGTTCCAGGAATTCCCA
CCCTGTCGACATGAAGATTCGCGTTGCAAAATGGAGTCATATTCTTGATGCAAGCTCAGGTGCTATCACTCTCAAGTAGCCCATCAGCTTATGGTTTCTC
TTAGCCACTTGTTAGACGGTTACGAGTGATAGGTTTTTGAACCATGATTCTGACAAGAGCTCCCTACTTCGATTCAATCTAATCACACAAGGTACTTTAT
CGACATTGATTGCTATGGAATGACTGGTCCCCAAGAAGGATGCAGCTCTCATTAATAAGTTCGTTGACTTGAGAGCAATGACAGCCGAATGGCGATTCCT
CGAGCCTTGGCGGACTTCATTACGCAATTTAATTCCGCAAGGAAACGGCGCAGCGGCTGAATCGACTCTGCAAGTCTTGTTTGCCTATCCCGATAAATAC
TCAATGAGACCAGCTATTTACCTAGGACTTCCAGGAGATCGGCGAGATGCTACAAGGCTACAACAACTTCGAGAAGCCATGGAGCTGTTCACGCTGCTTG
CGTTTGTGAAGAATAAATCATATAAAGAGATGATGATTGGTTTGGAGGTAGCACAGTCGGGTGGAAAATCATTTACCCACCCCAATATGGGACCTCCGGT
GTGTTGGGACTCTCTCACCTCGAGGCGATGGGGGTGGAAGAAACTACGTTTGCAAATGTTCAATGCGGGCCCGCGATTTACTGGAGGTGCAAGTTTCATG
GTTCAGCGCTGGAAGGCAGACAAAAACCTGTCCAATTGGCCGAGACATCAACCACAATCCTGGGCAGAGGTCAAAAAAAATATTTCAATTCAACAAATAA
TTGGGTTTTGCAATACAAATCTTTATTATTGGACATCCCAGCTACCAATACCATATGACATTGACCCAATTATTGACAATAAATATGAAAAAAAGTGCGG
TTCTGCGGCCCACCACAAATCTACGTTTGATGGCATCACATGGCACCACCGATGACATCAACAATGGGGTCCTCCACACTACACTAGCGTCGATACAATT
ACCGGTCAGGAGCAGACTCGTAGAGAAGCCCAGCCGCCATTCTCGGGCGGCCTAGCGTCTCATTTCAACATTGCATTCTCCAAAAACAATGGTCTCGAAC
AAGCTTCTCACCGCCTTCTTCTTCGACCATCTCGGCCAAGGCCTCTTTCGCTGCAAGCTCTGTGCCCAAGATCGCAAGCAGATGCCCGGATCCGGGTACT
CCAACCTTCTGGCGCACTTGGCTGGTAAACACGAGGGGTTTGAGGCCCAGTACTCATCCTTCGAGAGCAGCTCCATCCGGTCCCTCCAAGCCTTTGGCTT
CGTCCCTGAGGAGGCGAGCCATCTGTTCCAGTGGCTGCAATGGGTTGTCATGCGGAATATGCCGGTCCACGAAGTCGAGGACGAGCTCACTCGAGCCATG
AGCAAGCTGCGCCCCGTCACAGCTAAGGCTCTGAAGAAGTGCATAGAAGGAATCGCAATCAAGATCGGCTTCAAGCTGGAGAGTGAGCTGGGAACCCTGT
TCGGCCTGATGTTCGACGGCTGGACGCATGCTGGTGTGCATTACGTCGCCCTGTACGCTGTTTGTGAGGCAGATGGCGAGGTGCGCGCGCGGCTGCTGGG
GCTCTCTCCTCTAACAGACGGCTCGCAGACCGCTGACGCTCACGTGGAGATGTTCAAGAAAGTTCTCGAGGTTTACAACAAGACCCTAGACATGGTGGGG
TTTCTGGTTGGTGACAACTGCAACACGAACCTATCCATCGCGACCAAGATGGGCGTACCGTTAGTGGGTTGCGCCAGCCACCGGCTCAACCTAGCCGTCA
AGAAGTTTTTGGCGCCGTACGAGCCGTTGCTGGATGAGGTGAACGCCCTCATGGTGGAGCTGCGCCACGAGAACAACTTCGCGGAGCTGAAGAAGCACAC
CGACCTCCATCCTATCAAGCGCAACGTCATGCGCTGGTCATCTACATTCACGATGCTGGAGCGTTACATTCGTATTCGCTCCGAGATCAAGAAGGTGGAG
GCGGTTGAGGAGCTGATCCCAACGGGGGGCAAGCACCGCAAGCTCGTGGTCTTATTCGAGCATCTGAAGAAGTTCGAGAGTATCTGCAAGCGGCTGCAGC
GCGAGGATACGGACATGGCGGAGGTGCGGTTGATGTTTGATGTTCTGGTAGCGGAGTATCCTGTCATGGCAGAGCACCTCAAGACGTCCTGCACACTCCC
GCCTTTGAGACAGGTGTTGTGAAGGTGATCGCTGGGGCAGCTCTCTCGCAGTCGGAAACAGCAGCTCTGAAGCGCTTCGAGGTCAAGGGCCCAGCTGGAA
AGAAGCGTAAGGAGAGAGAGGAGGACTACGCGTCGTCGCTACTCCGAGGGAAGGGGAAGAAGGAGAAGCAGACCGCCGGAGCCACCAGCTACATGCCTCT
CGTGAAGATGATCCCACCGACTTCAAACACTGTGTAACGTCTGTTCTCGCAGTGCAAGCTCCTTTTGACCCCGCAGCGGCGTGCTATACTCCCGGCGAAC
TTCGAACAGCTCGCGTTCCTTCGCGTCAACCGCCCCATGTGGGATGTTACGACGGTTGCTAGCGTTAGTGCTGAGGAAACCCTTTAGATCGTAATCCAGC
TAAC