Description :
From Genome Similarity Track
Location :
Scaffold_280:31195- 32587
Transcript NameFunction/comments
Hyaar_Emoy2813463hypothetical protein

Sequence
1392 bases(100 bases per row)
ATTTCTCCGACCGTAAATCGAACGCCCCGTCCGGTCGTTCCTACGAAGCGCAAGCAACGTCCAGAGAGGAATTATGCCTTACCACCAAGACTTGCAGGGT
TGTCTGCCACTTCGCCTCTACCGCTTACTCCTGAGCCGTCAAGCCAAGTAAGTGTCTAATGAAGTTAAAGATGACCAGATATATGCTAACTTCACTATGT
ATAGGTTTCAAGTGCTACGAGAAAACGATTTCGCATTGACCGAGCTATGGAGGAGCTTACTAAGCCGTTACTAACCCCCTCGACGACTAGCGGGTTAGTG
GACATCATGATGATGCAGATGCAACAAGATCGAGAGAATCGGAATCTGGAGACCCTACGTCGTGAGTCTGATCGCCGTGAAGATGCTGCTCGCCGCGAAG
AAGACAGAAAGGAGGAGGCAGCTCGGTGTGCAGTAGAACGCAGGGATAAAGCTGCTCAGCTTGAAGAGGAGCGAAAAGAGCGAGAAATTGATCGAACCGA
TCGTGATCGCCAGCATTCGCAGCTCCTTTTGGCTCTTTTCGGTGGTAGATCGAAGTTGTCACCTCACCCGGCCATATAGAGCATCCGTGCAAGGGTCTTA
TACAACAGTCAGCATTTCTTCCATTTCGACAAAGCACAATCATTGCCATTGATTTATATTGAGAGCACATATAGTGAGATCGAATTATGTTTAACTCATA
AACCATAAATCTTAGACATGTAGTCATGTTCTTAACGCTCTACTCCCGCCAACACCGGAAAAACAGTGCGGATTTAACTAGCGTTGGTGCGGCGAACTCG
AACATCATACAATCGGTAAATGTTCATCAAACGACGCCCTCGGACATTAGGGTTGAAAGGCAGGCGAAGAAGCAACCGGCGAAATACCTTTTCACCGCTC
CCATGCCCCATTTTGCCGCTTGGAGTATGGAAATGACGGCATTGTTTAATGTAGTGATACTACGCTCATCTCCTCCTCGTCAACAGCTCTTTCCATATCT
CCATCCTTCAATGATGTGACGATTCTTCCGCTCGTATCTCCAGAGACTGGAAAAGCTGAGTCTGCAAGAACTCCATAATCATGAAGTGCGAGGTGTCGGT
CGCGAAGCTTCTCTCGAAATTGACGACTTGTATCTCCATCGTTCCACAATCCTGGACAATTGTGCTTAATCCAAATTACACATCCATCCGCACCAAAGGC
CACGGTACCTGTTACAAGGACTGAGTGGAGTCACCCGTTGTACAGAGCGTTCTGTAGCTCTCGGTTGCTTGGTGAAGCTACACGGTAGTTTTTTCCGTCG
ATAAATCCAAATTTCCGTGTTACCGGTGGCTTTCGTGCTTCAATCCAAGCAGCCCATGTACGCTGCTGGTCTTCAGATGGCCATGTTATCAC