Description :
From Genome Similarity Track
Location :
Scaffold_305:31195- 32453
Transcript NameFunction/comments
g4842.t1RAW42825.1 hypothetical protein PC110_g1003 [Phytophthora cactorum

Sequence
1258 bases(100 bases per row)
CCGCCCAGGAACACCGGCAGTTTGTAGCCGAGCGAGGTGTTCACAATGGCTGTACCGATGGCAAAGTTGAGTAGCTGGCCGAAGCAGTTGGCCGAGTTCA
AGGCACCAACGTACATGCCGATCTCTACATCGTCGCCCATCACGTGGATGATGACTGGCACAATGCAAGAGAACCACACGGAGGAGGTCATGCCGCAGAT
AGCCACGACGAACACGTCGAAGCCCTTGTTGCTGACCCAGGCCATGACGAGCAGGAACATCTGCGGAACGGTGGACATCGTGAGCACCCACTTGAGACCG
AGCTTGCTCACCAGGAAAGGCAGACACCACGAGTAGATGTAGCCGACAATGTTGTACAGCAGGTCAGCAGTTCCGCCGGCAAGGCTGACACCGTCGTTGT
AGGCGTCTTGCTCGGCCGTGCAGGGGTCGCAGCTATCGGCGTTCGCGGAGGTTCCGCCGTACACTTCAAGGCCGAAGAACTGTCCCTTGTTGCCGTTGTA
GGCCGTGTAGCCGTACTGCACGAAGAAGAAGCCGACGCCGTAGATGACCAGCACCTTCGGCAACGTCTTGATACCGAGCCAGACAGAGTAGAAGGCGCCC
TTGACCTGTGTCCAAGCGGAGACCTGCTCCACCTTGCTGGGGTCGAGAGGGGTCTCGTGGGCGAAAACCGTCGCGACAGCAACGCACACGATCATAATGA
CAGAAAGCGTTCCCATGAACCAGTGCATGGTGAGGTAAGCCGCGCCGAACGCGTCAATGTAGACGGCCACCACAATCGAGCCCAGTGTCGACCAAGCCTG
ACCGAGAGCAGCGCCGGTAGTTTGGCGGTCACCGGCAAAGTCGGCGACTAGAAGCATGGCCGGCGTCTGGACAATGTTGACGGTGATGTCCATCCACGCG
TAGAATAAAATGGTGAACACGGTCGTCCACATGCGATCGCTGTCGGCGCTCGATCCATCGCCCGTGTCTCCGAGGAGGTCGCCAATTTCACGCGTGTAGC
CCATGGCAATCCAGCAGATGACACTGAGGATACCGGCGACCACCAGGTAGGGGCGACGGCGGCCGAATCGAGACGTGGTGCGGTCACTGAAGACGCCGAT
ACTGGGGCCGACAATGACACCGACGATGGGACCGATGAACTGCGTGGCTTGCACGGCTGAGTTGGACAGCATGGTCGACAGGTAGGGCCCCAGAGCGGCC
CACTGCGCGGACCAAGCCATGTTGATAGCCATCCGCGGCATCGACACGGCGAGCAGCA