Description :
From Genome Similarity Track
Location :
Scaffold_248:31192- 33788
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_248-fgenesh-gene-0.9EF hand family protein

Sequence
2596 bases(100 bases per row)
CGTGGTCATTTGCAAACGAGTGCAGCAACTTGCCAGTGTTGTAGTTGATCAGCGGCATCGCGGCGTAAAAGTAGACGCCGCCGCGGGTATCTGCCCCCAA
TAACACGGGGAAGCTGTCCCAGAACTCGAGCAAATGGAGCGCGTGGCCCTCGTGGTCTCGCCGAAACTCACAGTTTGCCACAAATGTGAGCGTCTCGAAG
TCCCAGAGCGACACTCGACTGTCGCCGTTCTCATCGTCCAAGTTGGAGATCGTCGCGACGAGACACACGTGGAAACCGTAGGCGCTCGCCGAGACCCCAC
CGGGGATGTTGGTAAGCCGGCGCAGTACCGTCGTGTCCTTCATGCCCCTCGCCGAGTCGTGGTTCGTGTTGTCGTCGATGACGAGGATCGCGCTCTCGTT
CGCATTGGTCGCGATGATGAGTTTGTTGACCGAGCAGTAGTGCAGCCCGACGATACCGCACGACGGGTTCTTTGTCGATCCTAGTGTCGCTGTTGTAGCT
GGATTGATGGCCGGACTGGTGCTGGGTGGCAAGCTGTCGTTGCTTATACTAGTGCTGCTACTACTACTATTGCTCTGTCCGTAGAATACCTCCTGGCACT
TGCGCATCTGCACAAAGTTGAGCGCGTTGAAGACGCCCAACTCACCCTTTTCCGTTACCACGACGAGCTTCTTGCAGTTCTGGTCCTGTACGCACGCGAG
TACCTCGACGCACGGCTCGCTGCTCGTCGAACTGCCCGAGCCGTTGTGTACCGTGTTGTTGCTGTACCCAGCGCTAGGACCACTGGTCCTACTAGCACTA
GGATCACTCGCCTTCCTGTTACCCCCACTCCCAGTACCGCTGCCACCGACATTGCCGACGTGGCTGAACTCTTCGAGGCACGTGCCGCTCTCACCGTCCC
AGATACTGCACACGGGGCCGGTGACCACGATGAACTTGTTGGCGTTGTAGTGGTAGAACGCGCGCAGCGGGATCTCGTCCAGTTGCTGCACGCGTGTGCT
GCGAAACCTGTGCAGCGTCGCGGTGCCGGCGGTCGCCGCCCAGAGATCCCGACTGTGCGGGTGCATGCAGATGAACGCCGTGGGCTCAAAGCGCGAGAGG
TGTTGCGACGGGTTGATGGACTCGAGCTGGATCGCCTGCGACGCTGTGCCGTGTCCTCTTGAGGTAGATGATCTGGGTGCCGATGCCCCCACACCGCCAC
CAGTATTGCGTGAGATGTCCCAGACTTTGAACACGCCCATGCAGTCTGCGGTTACGGCGCGCTCGGTCTGGAAAAGCGCGATCTGCACGCCAACGAGCGG
CGCGCGGTGGCCTGAGAGCCGCATGACTACCTGGCGCGACGCGATGTCCCAGCCGTAGGCGTCGAACTCAAAGCCCACGCTCAGCAGCATGTCGTGGTGG
CTCGAGTACACGAGCTGCTTGACGCCGTGCGTGTGGCCGATGAGCGCCCCTCGCGCGCGGCAGTCGTGGATATCCCAGAGCTGAATGCTCCTGTGCAGGT
CACAGCTCACGATCAGATCGTGCTGCGGAACCTCGATGAGATCCATGACCATGTCCTGATGCAGCACCAGACGCTTCCAGAGCATCTTGGTCTCTGCGTC
GACGATCTTCCACACGTTGAGCACGAAATCGTTGCCGGAGCTGAACAGGAGCCCTGAGCTCTCGCAGAACCGGAGCAGCAGCTGGGCCGTGGTCGTCGTG
ATCGTCAGCGGCTTGATGAGCTCGAAGCTGGGACCGCACTTGGCTGCGGCGGTCGTCGAGTCCGGGAGGATTGCCAGGATGGGCGACTTGCGCGTCTCGT
TCATGTCGTAGAATGAGATCACAAAGTCCGTCGTGCTGAGCGCGAGCCACTGGTACTTGAACATGAACACGGCGTCGAGGATGAAGATGCCCGCTGTACT
ACTACTGCCACCTGAAGACGACGAAGAGCTTGATGCTGCGTTAGCTTGGCTAGTTCCAGCTTTCTCGCTTGTTGTACTGTCAGACCCTGAACTTGGGTTA
CCTCGTCCTGTTGCTCTGCTAGCGCTTGCTCTACTGGTACTTCCAGAACCAAAGGTATCGTAGGAATCGCCGCCGTTGGTCTCATTTGCTCTTGGGGTCA
CCGGGAGCACATTCAAAGCGGCTTTCCCACCAACTTCCGCCAGAAACCTGCCCGTGATATCGAAGAGCTTGACTGTCTTGGCCGTGTTCTCGATCGCCAT
GAGCTTCTTGAAGTGCGGACACCACTTGACCTTCTCGATGCCCACGCAACCATTCGCGGTCTTGATCACGTGCCTGGGGTTGCGCACGTACTGGTGCTTG
AGGCTCGCGGCCTTGTCGCGCATCGCGACCATGCCGGCATCCACGCAGAAGGACGTGAACTCGTCAAACTCCATCACACCGTCACCGTTGATGTCGATCT
CGTCGAACAAACCCACGAGCGCGTTCACGTTCGACGCTTTCTCCTCGGCGCTCTTCGGCCGCGGAAGCCCTTGAAGCACGATTTCGACAAAGTCCTGGAG
CGGGAGGCCGCCACCGAGCCGCTTCTCGCGCTCGCGGAACTCGTTTGCTATCACGGAAAAGCCCGAGCCTTTCAAGCGCATCATAATCTCCATGGC