Description :
From Genome Similarity Track
Location :
Scaffold_14:31183- 32225
Transcript NameFunction/comments
Phyci_90894DEAD/DEAH box RNA helicase putative

Sequence
1042 bases(100 bases per row)
CACGGTGGATGTAGTCCTTGCCGTGCGTAGGAATATCGTAGTTGATGACCACGTCGACACTCGGGATATCCAGACCACGCGAGGCCACATCCGTACAGAC
CAGAACGTTACGAGCCTTCGCCTTGAACTTGTTGAGCGCTCCGAGTCGGCTCGGCTGGGGCATTTGACCGTGCAGACAAATCGCCTGGAAGCCCAAGTTG
CGCAACATCAGCGTCACCTTCTGCGTGCCGTTGCACGTGCTGGCGAAAATGAGCACCGACTGTCCGGCGACCTCGTTTAGGACGTAGGCCAGGTAGCAGT
CCTTGAACTTGGCCGGGATAAAGAGGTAGTGCTGCTTGAGCGTCTCGGGCGTCGCGAACTTGTGGGTGATCTCGACCTTGACGGGGTCCTTGAGCGACGC
GCGCTGCAGCTTCCTGACCTTGGAGGTCATGGTGGCGCTGAAGAGGTACGTGTTCCTGTCGGCGGGCATGAGCTGCACGATCTGGTTGATCTCCTCCTCG
AAGTCCATGCTGAGCATGCGGTCGGCCTCGTCCAGCACGAGGAACTTCATGGTGCGCAGGCTGAAGCCCTTGGTGTTCTCCAGGTGGTCCACGAGGCGGC
CGGGCGTGGCGATGACCACGTGCGGCTTGCGTGCCAGCGCCACCTGCTGCTGCATCATGTCGATGCCGCCCACGACGCAGGCGCACTTCAAGCCAATGGA
CGCGCCGAGTGCCTCGAACTGCTCGCCGATCTGGTAGGCCAGCTCGCGCGTGGGCGCCAGCACCAGCGCGTACAGGCGCTGCGGGCTCTGCAGCAGGCGC
TGCAGGATGGGGATCACGAAGGCGCCCGTCTTGCCCGAGCCCGTCTCGGCCAGGCCGATGATGTCCTTGCCCGCCAGGCCGTGCGGGATCGCCTGCTGCT
GGATCTTGCTGGGCGCGGCCCAGCCCACGGCCGCGATGGCCTCGCAGATGGCGGCGTCCACGCCCAGCTCCTGGAAGCTCTGGGAGCCGCTGAAGCCCGC
GGCGTCCTCGTTGTGCGCGTCGGCGGGCGCCTGCGACGTGGC