Description :
From Genome Similarity Track
Location :
Scaffold_494:3118- 8025
Transcript NameFunction/comments
g16257.t1hypothetical protein
g16258.t1hypothetical protein

Sequence
4907 bases(100 bases per row)
GCTACTTCGATACCCCGGAATGAGTGGATCCCAGGATATTACTCTCATGCGTATCGCCCAGCAGCTGATGTCGCCCCGTGGGACGTGCGATACGTTCGCC
GTGTCTGCGTCCTGGAGATGGACTTGGATCTCCTTTACCACCATTTCTGCCGCCCCAGGAACTGGCTGATTCCTGTTCGCACTACTCACTCTCGCACTTG
GCGGTCGGATTTGATCACCACCGCCCAAGTGCAGGCGTTGTATGCAACCCGCCCCTGGGAGATCTTCGACACCACGATCGCCCCAATTTCTTTCAGCCTC
TCGGGATGGTTCGTGCCTATGGCTCAGCAGTATCAGGACCTCATCCATGAGCATTCCCAGGCTGTGTGGGAGGCTCTCCATCACTTCACGATCAGCGCTG
ATCGTCGTGCGCGAGAGACTTACCTCGAGACTTTGGCTGCTGAGCGCAAGCAGCGTCAGTCACGTTTCGGTGCTCGGCTGAAGGTCTTTCTCCGCGTCAT
ACTACGTGGGTTGGTAGAAGGACGGTGTGACCTTGACATCTTGTTGGATCCATTCTTCGTGTACCGGCCCAGAACCGGTGAGGAGAAGGTATGGTATCCT
GGCCACGGCATTTCTCCCAGGTTTACCGACTTGATCGCCATCACCCACGCGACCGACATTGCTGAGCCATGGCGTATACAGCACCGATCGGCCATCCAGG
CGCATCCGGCATATGGAATCGGGCGTTTGGTCGGTAAGTTCACCCCCTTGGCCTCTCCGTGATCGTGTAGGTCGAACTTCATAACTTCGTAGTATCACTG
TCTTCCTTCTTCCTATCTCGTCTCCGTGGGGCCGGCCACAGATGATCCCCTTGCTTAATACTCACTTAATCCACATAAACCCCTTCCACCACCGCGTGCA
ACCGTCTTGCACCTGTATCCACCTCTAATCAGTAGCATTTGCTACTGATCGTCCTCCGCCACCTCGTGTGATTGCATCACCCCGAAACGACTGCGGCTGG
TGCGATTCCGCTCGAACTCATATAGCAGCGCCCCGCAGTTGAGATCAGCTTCGTCCACCCACGATGGGTCGGCATAGCCCTTCCAGTAGATTTGGTATTC
ACGATGGACCCGCCCGTATCTGGTTTTGCGCCCGGATCGGACGTCCACGATCTTCTCGACTTCGAATTCGTTATCACCCAAATCATTCTCCCAGCTATCT
TCTGGTAGAAGTGCTTCATCGAAATCAAAACGATTTTCTTCATGGGTGGTTAGCGTCGCGTTTGGTCGATCAGGAAAACTCTTCACCTTCTTCAACTTGG
AGACGTGCACGATCGGAAACAGGCGATACTCCGTGTGAGCTACTTCGAGCCGAGCAGCATAGCGACCGACCATCTCAATCACCCTGAATGGTCCATGCCA
CATATGCGCAAGCTTCCGGGCGTAGCCCTCCTTAACTCGGTCGAGGTACAACCACACTCGCGTCCCAGCTTCAATCTCGTGGGGTCTCACGCCTTCGTTG
TGTTGATCGGCTCTAGCTTGTATCGCGGCCTTGAGACGTTCGTTCACTTCCTTACGCGCTCGCTGGTATTGCTGTTGAATGTGATACCGCCACCTTCGCG
GCTCGTGGTCACACCTCCGCGTACTGCCGAGCGGCAACGACGCCTCTAACGTTGATCGTGGGTCCCACCCATGTACGAAATAGAATGGCGTGTCACCGCG
CACCCGATCGTGAGCGGTGTTGATCGCGAAGGTCAGCCTCTCGGCGTACTCATCCCAATCCTGCTGATTCGTATCTGCGACGTACATTTTCAAGGCGCGA
GTGAGTGTCTGCACCATCCTCTCTGCCGTGCCATTAGCTTGTGGGCGGTACGCCATAGTAGCGCGCTGTCTCTGTCCCATTATCCGGTTGAATGCGCGGA
AGAAATCAGACATAAACCCGGGTTCCCGATCATGGCGGATTGCCTCACTGGCTCCAAAACGACGGAAGACACATTCTTCGTAGTTCTCTGCGATGGTCTG
TGCGGTCCGCGAAGCACTAGCCTTGGCGATCACATATCCCGAGAACAGATCTACCCACACCAACAGCTCCGTATTGCCCTTGAAAGACTTCGGCAGAGAC
GGTATATGGTCCATCGCAATAATCTGGAATGGGTACGTAGCCTGTACGTTACCTGGCGACTCACCCTGTACCACTGGGCGCCCTTTCCCAGTCTCACAAT
CCAAACATTCCCCCACGAATCTCTGGACACTCTTGAATAGGCCTCGCCAGTGGAAGTGGGCCTTGATTCGCTGGTACGTACGGCCGATCCCCTGGTGTCC
GCCCTCCAAACTGGCATGGTAATGATGGAGGAAATCTTGATGCAGGGTCGCGGGGACTACCAAACGCGCCATCGAGTCGCGGTTTTCGTCGGTCCGCGTT
ATGTTCCCGCAATAGAACAACAGATCGCCTTCGCCTACGTCGTAGTCTCCGGCGATCTTCGCGCACAGCCTCGCATCTTTGGAGCTAAGATCGGCAACGT
CTCCTCTCAGGTAAGCCTTCAGGTCCCCGATCCACTTTTCCTCGTTCTGTGCTCTGGCGATCCGCTCACTTCTCATGCGTTGTACGATCGTCTCTTGCAG
CGAAGCCGATACTTGGCGTGTCCTCCTCGCTGATCGCGTCACGGCGGTCACCTGGACAATAGAGTCATCGTTTGCCGTTTTCAGCACTTCACCTAATCGG
TTGATCGCGATCAGATCGTCGATCTCCCCTTCGGCCGACACAATCGCTCCTGCTTCTCGCTGTAAGGCAGTGCTTGCTAGCCGATCAGCGCTTTGGTTCC
AGTCGCGTTTCACGTGGAGTAGGTCGTGCGTCGGCCAGGCCTTCAGTCGTCCCATCGCCTTCTCGCGCAGCACCTGGAGTCCCGGCGCCTTACAGTCGAT
CTCCCCTCTCATTTGTCGGATGATCAGGTTGGAGTCTCCACAGATGATCACCCGCCCCTTGTCTTGGTCAGACAGGAGTTTGAAACCCAGTAGCAGACCG
CGGTATTCGGCTTCATTCACCGTTAGATCAACGGTGAACTCTGACGCAGCGGCTACTATGGACCATTCGGGTAACTGCCACACGATCGCGCTGTATGCTC
CCGCGCTCCTCTTGACACGTGCCGAGCCGTCGAAGCTTACGACCAGCAGTCTCTCGTCTAGACCCACTGTGGGTGGAAGCTTCGCGATTGTCTGCTTCGG
TTCCTTAACTGGGGCTATGGCGATCAAGGCATCGTCCACCTTTGACCGCGGAGTGATACTGGCGGCGATCGCCCCCAGTATTTCGTCTTCTCCTTTGGTG
CACTTCCTGATCTCCATCGTCCATTCCGACAGTAGAGCGGCCCAACGTCCTAGACGTCCTTGGAAACCCGTTGATTTCAAAAGCCAAGCGAGTGTCGAGT
ATCTTGACAGAACTTTGATTGATCGGTTGGTCAGGGTGGTGTAACATACGTCCAGGATTCGAAGAAGTGCGAGCACTTCCTTGTCGACCATACCGTAATT
CAACTCGTTCGACTTCAACGTACGGCTCGTGAAGATCACTGGCCAGTACGTTCCTTCGTGCTCCTGCACCAGCGCAGCAGAGATCGCCCACTTATTCGCA
TATACGACGATCACCGGTTGGCGATCAGAATCGAAGTGCCGTAAGATCGGGGTAGTTACCAGCTTGGACTTCAGCAGATTGAATGCTGTCTTCGCACGGA
CCCAGCGGTCGTTCGCTTTGCCTGTTTGATCGGCATTTCCGATGCGATTTATCTCATGGAAGTCCACTTCACGAAGTTCGTACAAGACCGCCGCATACAC
CGCGAAGTCCTCGATGAACCGACTATAATAGTTCAGGCTCCCGAGGAATGACTGCATCGATCGCAACGTTTTCGGGAATGGCAGCCTCTCCAGTGACTCG
AGATCTTTCGGCTTGGCCTCCAACCCTTCCGCAGACACTCGGTGACCAAGGTAATCGACCTTGCGATATCCCCAGAAACTTTTAACCACGCTGATCGACA
AGTTCCACCGATCACAGGCGTCAAGCAGTTTTTCTACTTTCTCGCAAACGTCGTCCCAAGAGCCGGCAGAGATCAGGATATCATCGATGTATGATCGACG
CCCCAGCACTGAAGGTCTCGGTTCATCCTCGGGTTCGCCTTCCTTGAACACGTCGACCAGCTTGGATGGATCAGCGTTTGGACTGATTCGGAAATGTCCA
TACAGCGCGTTGTCTATCAGTCGTTGGTAGATCTGTGGGGCATTCTTCAGGCCGAACGGCATACGCGTCCATTCGAAGAGGCCGAACGGCGTGACAAAGG
CTGAGATCTTCCGAGCGCGTTCTGTCATTGAGACTACCCAGAAGCCACTTGCCATATCCAATGAACAGTACCAGAGCGCTTTGTCCAGATCCTCCAAAAG
ATCGTTGACCAAAGGCATGGGGTACACCATCAGGCGGGTGAGACTGTTGACCAAACGGTAGTCAATGCACAGCCGAATGTCGACACCGTTTTTCTTGATG
ATGATCACGATTGGTGATGCCCACGGCGATGTCGAAGGTTCGATCATCTTTGCCGACAACAGACTTTTGATCAGCTCGGACAACTTCTCTCGGAACTGCG
GAGCTACACGTCTGACGCGTTGGGCCACAGGCGTTGCTCCTCCAACATCGATATCACATACCGCTCCGTTCGCGGCTGGCGGCAGGGCATTTCCTTTGCC
GATCAGCAAGTGACGGCGACGCCAGATGATTTGCCGCAGGCGATCAATCTCTTTTGGGGTATTCGCTTCCGGATCACCCACTTGGATGTCTTCGATCGAG
ACCTCGTCGGTTGAGCTGGACACCTCGGGAAGGATTGCCATGTGACCCTCTACGTCTTCAGCAAACAGATCGCCACCTTCGTGTAGGCATACCTCTTCGT
CCTCCGC