Description :
From Genome Similarity Track
Location :
Scaffold_181:3118- 5344
Transcript NameFunction/comments
Phymu_g6192myosin-like protein

Sequence
2226 bases(100 bases per row)
GTTCGGGAATGCAGCTCGTGTGATTCTAATGGCTTCAACAACACCTGCGCAGCGAAGCTGGTTCACCACAGCATCGATCTCGTAGATGCTCGGGCTCTTT
TGTGAGTTAGGCTTAATACAGCGCACGTAGTGCACCTCAGTGCTAGAGATGTCGCTCATCAGCAGTGACAACTGCGCCTTAAACTTGTAGCTCACTGTTT
CTTGCATGAACGTAGAAGTTTTACGGCTTACCGTGCTGCGTCGGCCATTCTCCATCATGGTTGCGGCACGGACGGCCAGATCGGAGTCCGTCATGAATGC
AGTATTGTCGTCATCGCCGAACACCATTGACATCAAGCCATTAGAGCTCGTGCCGAGCAGCTCTAATAGATCGGTTTGAAGCGagtccttgttcttctca
ACAAAGCCATCCGCGTCATACGTCACTGGACCCGCATAATGGTGCAACAAGAAATGTGTTTGGCTTAGACGCGCTCGCTCCAGGCGAGGGTGTGACTCGC
GCAGTGACACGAGCTTGGACACGAACGACTGATCACTACCCATGGGACGCACGCATTCTTCATTCAGCAGAGCCATCACGCCCATCGAGTTCTCCAGAAG
GTCCAGCATATCTTGGTTGTCTCGGTACTTCACGAACTCCCAAGCTACACCCTCTTGCTGGTACTCCTCTTGCACCGTCTTGAACACATCCAGCGTaaac
ttctgctgcaacttttCGTTTGCAAAATTAATGCAGAACTGTTCGAAGCTGTTGTGTTTGAACGACTCAAAACCAAAGATATCCAGCAAGTCGATGTGCA
GGTATGACGGCGTTGAAACAGCTCTACCCGCCGTATTGGAGATACTGTAGTTCACGCGGCGCACTAGATAACCGAATACGCGGGCGTAAATTTCCTTTGC
CAGAGCATCACGGTTATTACTAGCGTGATGAGCCGACAGCGGTACACAATACACTTCCTGGCGAGCCTTCACGGTACGACTGCAAAGCTGCTTACCCAAC
GCTCCAACTTCCACACCCAGAAGCTTCGCACACTGTTCgatttccttcttctgctgctcaatcTGCTCAGCCGTGACAGTCCCCGACGGTGCTGACACAT
TCAGAGAAGCAACAGCCTGGCTGGCATCGTCCTTGTTAGATTCCAGCGGCACAAAGTCAAGCTGTCCCAGGCGTAAGATACCGCAAAGAGCGCTAAAGAG
CTCATTCTGTTCCGTATCGCTGAGTCCAATGGTAGTCAGCGCATCTCGCGTCACCTGGTAGCGCTCCAGGTCCGTCTTCCCGTCCAAGATGAGCTTCTCG
TCTTGCAAATAGCGGAACTCCTTGGCTGAGGAGTCGTCGCTGAAGCCGAACGCGTCCTCCTTCGCACTCACAAGCTGGTAGAAGATGTGGTAGTTGCGTT
CACCCGCAGCCTGCGCCACCACGCGAgatttctccagcagataGTGGCGACACTCGGCTCCAACCAGACAATAGTCGTTGTtaaactggagctgcgtgaa
CTTTCCGAATCGACTGGAGTTGTCGTTGCGGATCGTTTTCGCGTTACCAAAAGATTCCAGTAACGGGTTACTCTTTAACACCTTCTCCACAACAATCGTC
TCTCCACTTTCAGCGGGATGCAGTCTCTTAGCGATGCCCATAGAGATGCTAGCAAGATGCTCCATCATGATTTTAACCGTCTCCGTCTTACCAGCACCTG
ATTCTCCACTCACAAGGATACTCTGAGGGATCCGGTGCTGCTTCATGTGGTGGAAAGCTTCGGCGCTCGTCGCGTACACGTGTGGTGGCATCTCGTCCCA
TGGTCTCTGCGTGTACATATCTCTCAGCTCCTCCGAGTAGTGCTCCTTAATCCATTGGTACGGATTTACCGCCACAACGATCTTCCCTGTATAAGTGTAT
GGCTCTTTCGCCAAGAACCGTTCACGGACGTTGTAGACGATGGCAGGTTCGTGTAGATGGCCCAGCTCGCACATGTCCTCAGCTCCGACGCTGTGCTCGT
TCTTATCCTCGACGTCCCCCTCGGGTGGTCCGTTCTGCAGGGGCAAAGAGTCGGGCATACCATCTTCGTTGAGGTCCACAGTGCGCTCTTCAGCGGGCGC
GTCCTGCTCGTATCCGGCGGTTGAGGCGTCGGCAAGCGGCTGCACACGCACGCGGAAGACCTTGCCACTTGCATCCACGGAGAGGACAGTGGCCGGCACC
CACACAAGCTTCTCGTCTGGGATGAA