Description :
From Genome Similarity Track
Location :
scaffold_5:31175- 32834
Sequence
1659 bases(100 bases per row)
CACGAGTCGACAAtttaatgtgaattgtgagtGCTCACAATTTTTGAtcggggagggtgtaacggggttacacgtaccgggtgtgaaggggtgggtcaca
caagacggtgtgaccatacaagtGTGTGGGTTACTcatgatggtgtgatcataaaatggtgtggctaactattaacaagaagtcagtacgtggctggact
gccagtagttatgcgtttcctgattaatagtagaacctatagatttagatataggcagcttagccgcaaataaaataagaaatgcagtttacatcctaaa
cggaagagttgattTGCTATGAGTTTAGGTTGTGgtttctcttggagtaagcggattgcgattcgctacactcttaCTGGTTCTaattatagaacgaagg
tcaccgaccttagctaagcttcctctaatcgaaagagcaacggcagccccgctgcactgcTGGCTATAACGTATGTTTCTGTCAAGTTTGGGGCTCACTG
GCTTGTTCTCAGTCATAATATTATGCATCATTATGCGCCGCGACGCAGTTATCACATCTTTCCCAGAAAACAGCAGAATGTGAATCCATCTGAGACAATT
ACGCCACAAGTATCAGTATAATATAAGCTAGGCCGATCAACCGTGGTTGCGGCTGAGCTATTTTAAGCTGTCAACTCGGATGTAGATCAATCAAAGCGTT
TGTTTACACGTTTGCACCACTAAATATTAtcggaagacttgctctatCACAGCACTGTCTGAGCGCATACTCGAACCTCATAAAGAGGACCAATGCGATG
CACATGCCCCATTTCGCTAAGAAAAAGATTACAGCTCAGTGAGCACTATGTTCTGGTGATGAAACATAAGCAAACAAAAGGCAAATTTATGCTCACGTGT
GAAGCATATCAACAAATTGAACTTTCGCCACATGCTTCGGTACCTTTAACCAAACTGCTGATTCCGGAAGAAtcctggcagtccatgagcaTGAACATTA
TCGTGGGATTATTAAAGTCTTGTCCAATGATTTCTGGTACTGCTACTTTGTGGTCGATCTGAGTAGAATGTCAACAAGGCTTACCAAATGCTAGTGATCT
TCCAGAGAGATTTACTCAAAGTGCTTGGCACCAAACTGAGCATATATACTGCTGGCCTTATATCGACAGAAGGTCAGACGGAACAAATTAGCTGTGTGGT
GAAAATATCTTTGAAACACTTGCGCTGCACTGGAGAGTAGTGCTCTCACTCATAAAAAAAAGCCGCGCTGAATACGCTGTGCACGTTGCACTTTTACGTT
ATATATAGTAGCCCCGTATTCCTTGAACACCACCACCACAAAGTGGGCTGGGCTTGGTGACGGTGGAGCTGTTAATCCGACTTGACTTGCTCATATCAGC
CCTGCTACAGTTCGTAGCAAGTTTATTCTATTTCGGCAATTGAGTTATCTGTATTGAGTGCGCGACACTACGGCTGAGCGCCAGGATGTGCATCAGCAGC
ACGCGGATATCAAAGGTAGATGGAGCACATACGAATGTGTAGCGGGTGAGAATATTTTACATTACACTGTTAATCAcccacagaagcagcatctACAATC
GCATTCAGAAAAGAAATAGAATTCGTTAGATGGCGCAAAGAGAATACAAGCACATCTGG