Description :
From Genome Similarity Track
Location :
Scaffold_32:311654- 312939
Transcript NameFunction/comments
Phyca_LT1534569349conserved unknown protein
Phyca_LT1534116950eukaryotic translation initiation factor 1b, putative

Sequence
1285 bases(100 bases per row)
atggcgacgaagggtgtgtggcagcttaagcaggtgacgattcgttactgccagcacggtggtagcagtcgttatgtgcgtcagcttctgggcgacgaac
gtttcctcaagttcgtggaggagaacccacaggtgcagttcgacacggagctcaagggagctcgccaccccatcctgatcggagactatggtgcgtttta
ggcttggcgtcatttatgtgggatattcgagctcaatgtattaacttgtttgtctttggttattgcagtgacaaaccagcgcaaggtggctgacatcaag
aaccaggatatccccttcattctgaagcaggtgcgaagcaattggatgaatatattgttctagcgagttgtactgataattccttgtttgtggcgatcat
acagctggagcgccttcgtaactctagcggccgtaagatgacacctatcaagaagccggtctactcgaagcgtccgaccatccagggcatttggcagccg
gatctagactttccggagttcaaaatcactgaccgcacgtagacgtcgatgccattaggggatgcaacttcaactgctcatgcttcgtcaattctgtgtc
gtcaagcgtagattgcagcactttatgcagggttatggtggcaactatgatgactgcaagtacactatggaggagactttcctgaacaattgaagcatca
aatatattctttcagcagccgccgagagacaggaagagaggctcaccacctcgtcttcctctttcctcatctaactgttttgaaccacaagactgcagat
tgcagaccggggcaactaaaagttacagcaacagggccctgcaaccgccttagaaaccgtgcagcaccacctgggcgtccgtgcagatctcttggtccag
aaggaactcacggatgttggttcgctggtcacccgacagctgaatgatctcgcccagttcgtcgtccttgacaatagcaccgttgcagctaaagttcttc
ttgaaagccttcaggatacgcttgacatccaggtcatcggccaggccctgcacagtcgtcaaacacttgcggccgttacgttgctgcacacgcacgtgga
ccttgcctccgccgatgctcgagtcgtccttggcgtcggcaaaagcgtctgtagatcgagaaatatacgtcacaatatagctcagtattcgcctgacagc
attgcgcacacactatcgccttgctgtggctacagggacgcaccgaaggtctggaagttctggatgtcggccatattcgctacgt