Description :
From Genome Similarity Track
Location :
Scaffold_1752:3116- 7063
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1752-fgenesh-gene-0.0Importin alpha-2 subunit
Pytar_ATCC12531maker-par_contig_1752-fgenesh-gene-0.1Conserved gene of unknown function
Pytar_ATCC12531fgenesh_masked-par_contig_1752-abinit-gene-0.19Transcription factor

Sequence
3947 bases(100 bases per row)
GCCGACGCATCGTGGAGCTCCTGCTGTTCCCATCACCGTCTGTCCAGACGCCGGCGTTGCGCACGGTTGGCAACATTGTCACGGGCGACGACTTGCAGAC
GCAGGTCATCATCAATCTTCAGGCATTGCCGTGTCTGCGCTCGCTTTTGGAGAGCCCCAAGAAGGGTATTCGAAAGGAGACCTGCTGGACGCTGTCCAAC
ATCACGGCTGGCAACCAGAACCAGATCCAAAAGGTTATTGAGGAGGGCATCTTCCCTTCCCTGATCAGCTTCTTGTCGACGGCCGAGTTCGATATTCGCA
AGGAAGCCGCGTGGGCTGTGTCGAACGCAACGTCAGGAGGCTCACCGGAACAGATTCTGTACATGGTACAGCAAGGTACGTTGCTCGTGGCGAGACGGAA
TTGCCGTCATGGATACAGCGACTCACGCGCATATCTATTTGTGCAGGTTGCATCAAGCCTCTGTGTGATTTGCTCGCCGCCAACGATGCGAAGGTCGTGA
TCGTGGCGCTGGAAGGCCTGGAGAACATTCTCCGCATGGGCGAGTCGCAGAAGGGTGCGGGAGACTTCAACCAGATGGCCACTCTGATCGATGAAGCCGA
GGGTGTTCAGAAGATCCAGCAACTCCAGTACCATGTGAATGAAGGTGAGACCATGTCTCTCTCGTGGAAGATATCACGCCCGTGGAAATAACGCTCTTTG
TTGTCATGTGCTTGCAGATATTTACCAGAAGTCGCTGAAGATCGTGGAGACGTATTTCCAGGGTGAGGAAGAGGTCGAAGACAGCCTCGCGCCTGCGGAA
GATGCGTCAGCGCAGCAGTTCACGTTCGGTGCTAGTGGTGGCCAGCCTAACGTGTTCCAGTTCGGCGGCAACTGAGTACGGAGATCCCTGTAGTCGGAAA
CCGGGCGCAATTGCTCATCTTCACGCACGAACAACAGAATACCCAACCGCATTTCATACACACAGAGAGAGGCACGGCAGTAAAGCCCAATAAATCCAAG
CGATAGTCGATGTTTTGATGATCCCGTCGAGTGACAACGTGTTTCTATGATCCAGGGTCGTTGTGTAGATGTGTAATTTGGGGTGAACATCAGTCCACAT
GTGCTACGCAAGGGAGCCAGCCCTGCGTGTTCCGGTTGATAGATTAGCGAAATGGGCAACCAACTCAACTGCCTCGAGCAGTGCAGAACGCATCACGAGC
AGCACCATCGGCTGCTCGTGCTACAGCAAGGCACGTAGGCGTACGCCGCTGGAGTGAGCGCTTCTCGCCGAGCTAACTTTTGCTGCAGGGAGTGTTTTCA
AGCGCAAGAAATTCGTGTTGGGGATCCAGTCAGGGTCAGAGAAGATTCACCTGCGGCTCTCAGGGGACGAGCAATTGTGAGAGAATCACTCTAGCTTTTG
AGCTGAGTGGATTCTAGACCAGCTCACGCTTCTCTTTTTTGCGTTGGCTGCACGTTCTGGTCCAGTTTCCTGTGGAAACCTCATGAGGGAAACAAGTCGG
CGACAAAAATCGACGTGTCCATTGTTGGGACGATCAAAGTGCAAGGTTGTTTCCACGGCCCTCCGGTCCAACGACATTCGTTCACAGGCATACTGTATGT
GTGATGGGAGCCAGGAAACACGGGCTTCGCGATCGTCTCGCGGAAAGGGGAGGTGCTCCTCGATCTCGAAGCGGACAATGATGAGCTACGGAACGTGTGG
GTGAGTTTCGCTGTCTAACGATCCTATTGAGAACGTGGTAGGGGACTGAGTGAGTCTCATTATTTATTTCGCACAGGTCACGAATCTGCAGCTCTTGTGT
GACGACGGCGAGGACACGGCGGAGGCTATTGAAACTGCCCAGTCGGGGTCAAAGTTCCGGCGCATGATCGAGGAGAGAAACAAAAAGCAGGCCTACTGGG
CGCGGCGAACCCAGGAGCTCGAGGACCGCAAAAAAGACGCAGAAGAGCGCAAGAAGCAGTTCACAGGAGCCGGCATGAAGTACACTGCGCTCGCCATGAG
CAGTCGAGTCCCCTCCGCTAAATCGGACAATTAAAACCAAGGACGCCCATGTGGGCGCAGGTACTCTCGTCGCGATTAAATAAGAGGAAGAAACCTGCAC
GCAGCCAATGTCTCGCCACACTAAATGAACGGACGCGACGCGCCAGTCAGGGACAGTCGGCGAAAAAATCGGAGATGCCTTCTGTTTCATCGAGATTGAA
GCAAAAGTCTGGATCCGTCTGCGCGTGAAACAAAGCTTCCCGTGAGCGATAGATGCGGAGTCAGAAATGGGCCGTGCATGCACGCGTACCTTGAGTGGTG
CGAGTTTGAACAGCCCGCTATCGGAATCGTAAGACTTCTAGCGTCACGATAACCAGAACTTGTGAGACTCCGTTCCAACGTAACAGTCATGGTGTGCCTC
CGTACCTGGTCCACTTGAGGAGCTGGACTTTGTGGGGCGGATGGGACTGCAGAGAGTGCGCCGGCCGTGCCCTCGTCTCCTTCGGCGAGTTGTCGAACCA
AGAAGACATCGACAGGACCATCTGTATTTCAGGGCCAAAGAGTGGGAATGTGAGCCGTCAACCATGGGAAAATACTCGCTAAAGAGCCAACCACTTACCC
GACGACTTCAGGAAAATCTGATAGCGCCGTTTGCCGCTCGGCATCCCTTCATCGGGGTCTGGTACTTCCAGACTGGTTCCTGGCGGAGCCTTTATAGCCA
TGACGCTCTGGTCCTTGAAGCTATCGAGGCTGCGCATGTCATCATGTGTGATGTACGAGAGGCCTTCGAAGCCACCCTTCTCAAACGCTTCCTCCTCGTA
CAGTCTCCGGATGTTTTGGCTGACGGTCTTGATATGCTGATCGTATTTCCGCTCTTCTTTCATGAGTTCCGAAATCGTCTGAAGCAGGTGCTCCATGTCA
TGGACGTTTTCTGAAGTCCCCAGCGTTCCGCTTGCTCCTCTACGTATCACCACACATCAGGCATTCAGCATCAAGCGCAATGAGACGCGCTATTATTGCG
AACCCTACACGTACTTCCAGTGGATGTTGTTCTTGGACGTTTTCTCTATCAGCCCGATGCCCTCCAACACATTGGTGATATCGTAGATACGCCGTTTCTG
CTCTCACGTATCGGAGCGCAGTAAGTTCTTCAGTACTGAGGATGCTTGACGCTGAGTCTATTGTACGCACCTGTACGCCGAGAGAGACGGCGGCACTGTT
TAGATCGAGATCTCCTGTCGTGGAGGACTGAATCAAGTCCACGAACTTCTTTGTGAGCAGCCCGAGCGAGCTGTCGTATCGGCTGGCTGGAGACGCTTTG
GCGCTCCCCATGGTGGCTGGACACGCACTCAAGTGAGGATCACGCCGCGTGTGGTGCATCAAGGAGGAATCACTATCGCATCGTTACCTGGCGTCGTGGC
GTGTGACGGAGTGTACTGCGGCGTCTCCGCCGTCGCCGCGGCAGTCGATCGCACGGGTGATTCGGGCTCGTCTGGCTTCGACTTCGCGCGCTTGGCCTTG
CGCTTGGCCTCGTCGTCGGCTGCCTTGGACTTGACCATCTTCCGTTGCTTTGCCTGTCGTGGGTTTCTCTCAGGCCATTTCTTGAGAAGAGCAACATATC
GATATTCGGAGGTTTTGCAGTATCGCATAACGGAGGTTGTTCGACCGAGAGCATCCACGTCAACAATCCCTCCCGGCCAGAGTCGAGCAGGCCCGATTGG
AATCTTGGATTCTGCCAGAGCAGGCAACTATGGGCGGGTCGCAGAGCGCCGAGAAGCGTGAGCAGTCGGACGTGTACGAGGAAGACGAAATCGAAGAGAA
CCGTACGTACTGCCGCCCCTGCCGTGTTCTTCGTAGTGCTCTATTCACGTCGCTCTTTCCATGATTCAGCACACCATGTCGAGCTCGGCGACCAGAACGC
CGTGCGAAACATCTTGGACGACACCATCGTCGAGTTTTGCCAGAGCC