Description :
From Genome Similarity Track
Location :
Scaffold_947:3116- 4181
Transcript NameFunction/comments
g6635.t1hypothetical protein

Sequence
1065 bases(100 bases per row)
TAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCACCCACCGCCCGCAACGCGGGCGGCGCTCGGCTAGTCCCCTACAAGTAACA
GAGTAACCTGTCCGTCCGTCCGTCCGTCCGTCCGTCTGTCCGTCATTCCGTACGCACCTCGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAATA
GCTGCCGAGCGCAGCGAAGGCGGCCCTCCCATTCGCCAATACTATAATTCGAGCCCTCTCATTGGCTATTTAGTGGAGCCTCTGCGCGATTGGCTATTAT
AATGCGTAGAGTGGACTACATCACATCGGAAGTAGCCGAATGAAATCGCTGCTGATTGGACAAAATAAACCGCCTTTCAACAACGTTTCTTTTCATTCCC
ATACGTGGTCGAGTTTCAGAGAGATTCCAGGCAAATTCTCCCGGTGGTGAAGGGCGGCTCGGCGACAGAGACAATCGACGCATGCCTGAAGTCATCCGAA
CTGTGGCCACTTTTCCAGAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCACGGCTGCCACCTCCGATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGT
ACCTGCTGGAGGTTGGAGAGGGGAGACACGAGGTACACAACGATCTGGGAAATGACTACATTAAGATTCCACGCGACATGCTCATCGACAACCCCGCCGG
TGATCCAGATGAGGACGAGGAGATCCGACCGGGAGCTATTCCGCGAGGTATGCGGCGCATGATCGACGAGATGTACGCCGACATCAACAATTCGGAAGTC
GCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCATCGTATCAACGAAGCCGTAGCGGATCGCATGACTGGACCAG
CTCGAGAATATGTGTCCACGGACTCAGTGGAGGATGACGAGGACGGGAACTTATTCGAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGGCATCCCACC
CCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATCATGATGCGGAACTTAAATCCCGACCTGG