Description :
From Genome Similarity Track
Location :
Scaffold_195:31155- 33229
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_195-fgenesh-gene-0.3Proteasome subunit beta type

Sequence
2074 bases(100 bases per row)
CCACCTAATAGTTTTTTTTGTTATGGATGGTTGCGTAGATCATTGACGCAAACGGCGTGCGCGTGCTGGAATTCGAGTAAATGCTGGATGGGAAAGCGGC
GAAATCATGAGCGGGGCAGTTCAGATCGAAGCAAACCACAGCAGCAAACACACACAAACACACACAAAAAAGAATTTAACAAGACGTGGTAAAAGGAACA
GTCCTTTTATCCACATTAAAAAGACGAGTTTCTCGTTTGCTGTCTTGTGTTATTTCAGAAATTTCTTGCTGCATGAGCGACTTCATTTCGTGAGACTCGA
GGTGGAGATGAGAACGAGCCTGAGAATGATCCTTTTCAAGCGAGCAATTCAGGGATGAAATTTGTTCAGTAAAACGTGTGTTTGCACCAGTGCTACGAAA
TACAAAAGCGTGAAGGCGAGAATTTTCCTTCAACGGCGAAAGTGGAGATACGCAGTTGCACGAGTTGCTGGTGCTATCATGCTTGAAGACAAAGGATAAA
GACACGAGCGAGTGGAAGCATAGGCAGCTCTATCTGTCGGATATATTTTGCCCCATCACAACGAGCTTAGAGTAGTGCTCTCGCTAAAGACAGGGAAGAA
GGCGCAACGTGGTCAAGGATCACACTCTCATACTAATTGGTAAATCATGGATTGTCAGATAAGCGAAAAAAATAACAACATAAAAAGGAAACGAACGCCA
TGGAATTAGTCATGAGTGCGGTCAAATGGCTACAGCACAGGCCGTCTTCATCACTCGTTAGAGTCCAACGAAAAGATCTCGGCGCATGTTATGTCGCGAG
CCTGAGACAAGTCCTTGCTCACAATGAACAATACATGTTGTAGCAAAGCAACCTGATGCTTACACAGAGACGCTACCATAATGAGAACTGGTTTCCCTTC
GAAGCAAAGCGGCAAGGAGGTTAAGTCGACAGGTACTGTATCAACATTCGTTTTTGTGAACCCACTGACCACACACACTCAAAGGGAAAAGAAATGGTAA
TCAAAGGCCGTCAGAAAGAGAAACACGAGCTCGAGGAACAAACGACGAGAAGACAGAGGAGAGGGGAGACAAGACGAAATGGCGGGCGATGTCGGGAGGG
ACCACTTGGTACGTGGAGCGCCTGTGAATCACGTCAATCAAGGTTAATGGTCGTCGCTACTCGCTGCTGCTGAAAGAGGACCCGGGAATTGGCTACGTTG
CTGTTGTAGCATTCAGTGAGTATGGATCTTGCAGGGGGTAACGATCGATCCACTCCATTGATGGTTGCTGCGAGAGGAGGCTGCACAGCGGTCGTTGCTG
TGTTATTGGCGGATGGCGCAAGTGTGAACCTGGTCGACAAACAAAGATGGAGTTCGTTTGCTTTTTCTGTTGAGACGGGTCACGTATTCATCGTTTCTTT
GCTATTGAAGCATTCGGCAAGAATGGATCTAGCTAATCCGAACGGATTGACTCCGCTTATGGCCGCTTCATCGCACGGCCATGTGGTAGTTGTCACCTTG
TTATTGAAGCATTCAGTGAGCGTAAATCAGGCAACTACAGCCCCCATGCGAGGATATCGCATGCAACGTCGTTCACCCTACAGATTCGGACTCTGCGTTA
ATCATAGCTGCTGCAAGTGGGCACACCGAAGTGGTTCGAGTGCTGTTGCAATGCTCGACGAGCGTGAACCTGGCGGATACACTCCGTTGATGGTTGCTGC
TCAAAGCGGCCACGTCGAAGTCATGACAATTTTACTGAAGAATCCTGCAAGCGTGGATATGATCGACAAGGATGGGAGAACTCCGCTACTGCATGCTGCC
CGAAGTAGCTGCACTCAAATTGTAGTTATACTGTTTTGGCATTTTGCAAATGCGGGTTTGGCCGACAATCAGGGAACGACCTCGTTGATGATCGCTGCTG
AAAATGGTTATACCAACTTTGTTGCAATATTTTGCTTGCGTCAACCAGGTGAGCCATCGCAGAGCGGCTCAAACGTCAGGACTACCAAAGTCGAAACGGA
GCAATGCAAGTTCATTGAAGCTGTGGATCGTTGGGTGCACTTGAGTCACCCAAACGCGGTAAAATTGTTCGGAG