Description :
From Genome Similarity Track
Location :
Scaffold_9:311456- 313461
Transcript NameFunction/comments
Physo_523326Major Facilitator Superfamily (MFS)
Physo_306660Hypothetical protein
Physo_524204Hypothetical protein

Sequence
2005 bases(100 bases per row)
TAGTTTTATTATTGCTTGGCATTGCTGGTTTGCTCCCACTTCTTGATGTCATTGATTTCGCCAGTCCAAATAACATGAATCATCTTTTTTCATGATATTC
GAGCAAATGTCAGGTCTATTCTAGATCTACCACGAAGGCAAAAAATCGACAATGCATGGATAACCAAGGCCCGAGGCTTGCATGAGCCTTCTCTCAACAC
CAGCAGCGCTAGATAGCCCACCCACCACTCCTCAATTTACTTCGAGCACCACAAGTGACAACCCCCTGACGCGTCCGATGTCCTTCGCTCGCTTCGTCAT
CGGTCTATTACTGGCATCTCTCGCCGTTGTCAACGGTGCCGCCATCTTCCCGAACTGCAGCGCCGCTCAACTCGACACGATCAAAAACATCGCCCAAGCC
ACCCCTCTGGCCAACTACCTCGGCATCTGCAACGTCGTGGGCAACTACGAGATTTACCCGTTCAAGACGCCTCCCAACGGGGCACTCCAAGATTCCGTCT
GCAGTCACCTGTTCTGCCGCACCGCCCTTAAAGTGTTCTACTGGACCTCGAACCTGCCCAAATGCTACCTCGATATCGACGGAGACTACTCGTGGACCCC
CAACGCGCACTTTCAGAGGATCTGCCCGAAGATCTGGAGTGCGTGAAAAATATTCTTCAGAATACCCCCCCCCAAAATGTAGTGGTGTGATGGAAAAATA
AATGTAATTGTCGTTCTCTAATTCTCCTGCTTAACTACAGCCTAGCCAAGCCTCGACATTCGGATCACAAGCGTCCCCAACGCCACGCTGGATATGTAGT
TTACGCATCGCAATATACCCGGACGTCGTTTCGCATTGGATGACCATCATCCTGGTGTTAAAGCAGATTCCTTGCTTGCCATTGAGGGTGCATTCCTTGT
ACTTCACTCCATTGCAGAGCTCATCCGTCGTATATTTACTGGGGGCCATTGCTTCTCGGTTGAGTGGAGGCGCGGAGGGGCAGATTGAGCTTCCGAACGA
GTCGAGTAATAGTTTATCCTCAGCTGAGATTCGTTCATCCGTGCAGGTGAGAGGGTACTTTTCACCTGAAATGGGCAAACACTGCGACTCGGTCATGTTG
CACGTCCCAGTAATGAAGCCGTTGCAGCAGACAGCCATTCTCGCTCGGATCACCAAGGATTTCAAGCTCGTTAGGGGGGCCAGAGAAGGTAAAGTGGGGG
CTCGTAGCGCGTGAACGATGTCGAGGTCGTCGAGTTTGGACAGCCCTTCGAAGCTTGGCAACTCCTTGAGCGAGTCCAAGACCGCTAGAGTCAGATAGCG
TAAGCGCTTTAGAGATGCGAGCGATGGGATCTTCTCAACGTTGGGGATTCCACCGAAGTGGAGGAAGGTGAGGTGAGGCATGTTGTTAAAGATGCCGTCG
GCTATGGTTGTGAGTCGTCTGCTTGTGTAGTCGCCCTCGAGGTGGCTATAGCATTCATGGATCAATGTAGTTGGTAAAACATTCTTCACTACTATGACAC
ACTTTGAAATACGTACAAGTATTCGAGATGAGTGAACTCGGCAAGCCAAGCTGGAAGAGCTGTAGTTTTGGTGTAGACGAGGATTAATTGCTCGATGTTG
CGGCAATTCTTCAACTCTTCTGGTAATTCAGGGACCGCACGATTAATAATTTGGACGATTCGTAGTTCTCCGGCGATGGCAAGTTCTGCAAGATTCGACG
TGGTGTCTGGTGGGTCGATCCAATCGGAATATTTTGTGGGCGAAGTCTCGCGGTCTACGAACACGAGGCAGGTGCAGTGCTTCTCATTGAAATTCCACTG
GTAGCTGGGGATGACGCACTTCTCGTACTTGCTGCACAACTCCACAGTGGACTGCACAGAGCCGACTGAATAGATAAACATGCAGACACCTGCAACGAAG
AAGATAAGCGATAGAAAAAGCTTGGGAACAAAATGCTTCCCGAATTTGGGCTTCGACAGCGACTCGGAAAGCTTTTTCGTGATTGCGGCTTTGATGCTCC
CCGTG