Description :
From Genome Similarity Track
Location :
Scaffold_358:31145- 33117
Transcript NameFunction/comments
Phymu_g9057conserved hypothetical protein

Sequence
1972 bases(100 bases per row)
GGTGAAGTCACCGATTGTAACGCCAATTTCTACATACATCTGTGCTTGCTGCCTTTGATCCTCCCAGATATCGACCACACTCGCGCAGTCCGGCCTAAGA
CTGAGTTGCACGACCATAGCAACGCCAGCAGTAAACAACCTCCGCAGGTCTGTTAAAACCCCACCATTTTTGCGAGAATACAGGGCCGCATCCACATCGA
CACCATCACACTTGCAGTTCCATATCATACCGGGACCACTGGAAAGAGTTTCCTTGCCCGTTTCTTCCAGTCCCATCGCCCTCAGCGTCCGAATCGCTCG
CTGGAATTGAGGCGACGGGTCTGAAAACTCGAGCAATCTGCTCCACGCGACTTGCTGGTCTGTAGCGGCTCCACAGACGTGCACATTCCATTGTGGGTAA
CATCTACGCTCCCCTGGCTCCACTGTCTGCGTAAGGTGCGAGATTTGCTCCACGAACGCTTTATTATCCACTATCGAAAGGATCGTAAGGAATTCAGTTG
CTTCTCGAATGTGTTTCAGTTGGTTCACATTCTCCAGATTTCCTTCCTCCAGATGAACAATTAAGTGGATTCGCTGTCGTTGAGGCTCTTGAGTACCTAA
GCGGCCACCTAAATGTCGCCTGCATTCCACTTCCAGAGTACGTGGCTTTGCCCTGGGTAACACAAGAGCGTAAGGTGGCATGCCAAGCATTGAGGAAAGT
CCAGTCGGTCGTCATTGCAGCGGAAGTTTGGAAATGACACTATGTAGATGCTGAGAAGCAATAGCTTGGCCAAAACCTATCACTCATAAGAATCAATCAA
TCACAACTATCTATCACTTGAAACCTGTCGATCATTTGCCGACCTCtttctccgtctccacttcCTTTCTGCCAGGGTAGGCACAGTTAAAATGGCTAAT
TTTCTGCCATTTTTTTTATCGGATTGACGTACGGTATCTTGAAGATTTTGGACACTTTTTAAAATTGGTTAAGAGAGCGAACCTATAATTGTGTACCTAT
GCAGTCTTTCTCGACTTAGAACCACCGTTTGTAGCCACTTCGGACCTCGAACGTGCAGGTCTCTTCGCCCGTCAGATAATTTTTGCGGTCGTATTTTACG
TACAGCTCACCCAAGGGCAAATGCTCGTAGTAAATCCCTCCAAAGTCGATCTTGACGCTCTTGCCATCGGGTTGGTCAGCCTCTCTCCGCACCTGTTGGT
TGAAGCAGTCCTCTTGGGGCAACACGCCCAGTAATTTAACAGTGTGACAGCCACTGATGACGCACCCTGGCTGTGTGAaagtctccagcttcacgaCTGC
CGAGAGTTTGGCGGGACGCTCGGCCACCTGCATAACCAATTGCGCGTCCGAAGAAATGTTCACAGGCACCACAGTGTAGCCATATTTCACATGGCTCACA
CAGCCTACAGACCCGTTGGTGCAGCGCTCGGCGGCGTGAGGGTCTAACACCCACTCGAATGAGGACTTGTCCGTCCGTTGACGCAGgctggagccgctgc
agaCAGCGACAAGCGACGAtaggaagagcaggagccGATACATGGATAATAATGAAATCTTGGTATCTTCTGAATTATTTATTTaggtatacatgtatac
aaaAAAAAGAATTTAGGATTCAGAAAAGATCAATAAATAATTATGTTGTGGCAAAGATAGTAGCTTTGGGGAATCACTCGTGTATGAGCCTCCGTTACGG
TGAGCCTCCATTACGGTGAGCCTCAGTTCTAGTGCGGTGCATGTAATAATGGTGCTGAATCACCACAAAATTTACAAGAAGTACTGGTGCATCTTGGCTG
CATCGCGACATGATGTCATCACAAGTACAAAAGCCAGCTGGCGGGATTTCCTTGGCATCATGAAAGTAGTCCAATGCTGAAAGTTCCAACCTCGAGATCC
AGACTACGGCACCCTACACTGCAGACTGCCGATCGCTTAACAATGCGTAAAGTCAGTCACACGCAGATTTCT