Description :
From Genome Similarity Track
Location :
Scaffold_630:3114- 11060
Transcript NameFunction/comments
g17620.t1hypothetical protein
g17621.t1hypothetical protein

Sequence
7946 bases(100 bases per row)
TGTAATGGGCCCCTCCCATTTACATATGTAGGTAGATCTATATAGGTAGATCTACAAAGTAGAGACAAAGGCACGCGGCTAGCGTGTGCCTCGTTGTCAT
CCTGCGATTGGTTGAAAGTGGGGAGCCAGACCCATTTTCGACCAATCAGGTGTCAACCTGCATTTGAGTGGTTCACATGGATCCGAGGGCCACCCGCCCC
GGTCCCAATAATAAACCAGAGTTGATTTTACCCTAGACTAAACACTTGGTCTCAGTATACCTGAGCTTATTGGACGCTTCCTCACCGCTACGTGTAAGCT
AGTGACGGGCACTCACCTGGCCCGTTACACCTGGTAGCACTTCGTAGTCCTTCCCATGACCAAGTTCGAGATGAGTGAAGACCAGCCCGCCGGACCTCCA
GTGATGACCCTGGAACACGCGGCCTTCCCCCATCTCACGTCTATCGAGTGGCAAGCGTTGCACCGCCTCGCGGCGGTGTCCGGAGAAACCGTCGTCACGT
CGCTGCTGAGCTCAGCGACCCCCGACCAACAGCGCCAAGCCATCCAAGAGTTCATGGACCGCGAGCTCGCCGAAGCAAAACGGCGAGTATCAACTCCCTC
GCATGCGTCCAGGAACAATGCCGTCAAGATGGAGACATCCTCCTATTCTGGCGAGGGTCCTGATCGCCTACCTCTGAATCGCTGGTTCAGAGAGATCGAC
ATCGCGATCGCCTCGAGGCTAATCGAGGCGCCATCAGCCAAGGTGAACTTCCTGCTATCCCGTTTATCCGGAAAGGCCAAAGAATGGGCTCTCGGCAAAC
TTGTCGTCGACCAGTACGCGTTCCCGACTCTGGAGGCACTCCAGAGCGACCTGCGTCTCGCCTTCGAACCACCGCAAGATGAGTCGCGCGTTCGAGCTAC
ATTCTTCGCCCTAAAGCAAGGCAAGATGGCCATGCGCGACTACGTCCAGAGAACGCGACACCTTGCATCGTGTATCGTCACGAAGCCGATCGACATGGCT
TCCCAAGTCCATGTCTTTGTGTTTGGTATGTGTGAAGGTATGACGCGGTACTGTCTCACGCGCGCCGAGCCTGCCACGTTGGAAGAAGCCTTCGCTCTCG
CGCTACGCGAGGACTACCTGGTGACGTCGTCATACGCCAAGACGATGCCTGCACAAACTCGGGTGTCGGTACCCGAGCCAATGGAGATCGATGCGATCGA
GGCTTCGCAGAACCGACGGTGGTCGTCTTCTGGGAGAGGCCGCGGTGGTCAGAATGACCTCTCGCTGAATTGTTTCCGCTGCGGAAAGCCTGGTCATCGC
GCGGCGGTGTGCCGCGCGCCAGCTCCGATCCTCGCCCACATGAAGCACGTCACGCCCGACGAGAGGATTCTGGCCGCACAGCCAAAAAACGGCCGGGGCC
AGTAGGTGCGGGGCGACCTACTGGCTGGAACGGAGGTCCGGGTCCCCCGGCGGCAGCCCGACCTCCTAGCCCCCCTGTGCTCTATGCACACTTTAATGCC
ACCACTGCTAGTGGCGACTCGAGGCTGATTATTGTCAGCCTTTATGTCGCCGGTGCCCGACGACCACTCCGCGCGCTCCTGGATTCAGGAGCGACGAACA
ATTTCTTCCGCGCTTCATGCCTGTCGATCCTACCCGCGGGTGTTCCCGTGCGTGATGTGCCTGGTGATGTCGTTGTCAAGCTTGCGGATGGAAAGCCGTT
CCGTGTCGCGCGACGAGAAGTCTCGTTGCCGTATACGTTCGACGGCTTCCGCAGCAATGACAACTTCATTGTGCTTGAGATGAACTACGCGTTTGACTGT
ATCCTGGGTATACCATGGCTGTCCCGGTATCAGCCCCAGATCGACTGGTTAGCCCGGTCAGTCAAACGGCGACGCGACTTCGATGTGAGCGAAGTCTTCA
CGCACCTCTTGGTGGCACCAAGAGACTGGCCCCATGTCACAGTCGTGGACGGGACGTCCACGACGCACGTTGTGCGCAGAGCGAGCGATGGCCCTCTCTG
CACGACTTGCGCAGTACTGCTGACTGATGACGACAGCGTCGAACACCCGTCCGGTTACGGGCGCGCGAGGCGAGCGGTTGAGCATCCGCGGCTCCCGCGG
ACGAGGAACAAGGCGGCGGAGCGCATGGCGCTCCCAGCGACAAGCCCGACGGTCGAGCAGGGGCTCCCGCGTGTTTACGAGACGGTCGAGCAGGGGCTCC
CGTATGATGATGAAGCGGTCGAGCAGGGGCTCCCGCATGCCAACGAGGCGGTCGAGCAGGGGCTCCCGCATGCCACCAAGACGGTCGAGCAGGGGCTCCC
GCATGCCATCAAGACGGTCGAGCAGGGGCTCCCGTATGATTTCGAGACGGTCGAGCAGGGGCTCCCGTATGACTTTGAGGCGGTCGAGCAGGGGCTCCCG
TATGACTTTGAGGCGGTCGAGCAGGGGCTCCCGTATGACTTTGAGGCGGTCGAGCAGGGGCTCCCGCATGACTTCGAGGCGGTCGAGCAGGGGCTCCCGT
ATGACGATACCGCGGTCGAGCAGGAGCTGCTCCCGCGTATGAGCGGCGCGGTCGAGCATGGCCTCTCGCGCCTAGAGGAGGGTGAAGTATCGTCCGGCGA
CAGCGAAACATCGGTCTTGAGCAGGGGCTCGAGACGCACGAAGACATCCCGACGGTCGCGGAGACGTTTGAAGCCGCGCCGCAGTCCAGTGGAACTCACG
ACGCCACCAATCGAGTCGGTCTGTGCAGTCGAATATGTGGGAGGTGTTCCCAACCACGCTCGAATGATCAAGGTCGCGAGTCCACCTCGCGACGCCAAGT
CCATCACGGACCTGCCAGGTCTCTCCTGGAAGAGCTTCCTCCGGGATCTCAAGGCTGGTGACATCGAGCAAGTGTGCCTGATCACCGATGCCAACCCAGT
GTCTGACGAGACGAACGCAATTGCCCATGATGACACGTCGTCGCGCCCGAAAAGCGCTGAACCAAAGTCAGCGCGCGAGGAGCGCTTCGCTGCGCAGTCG
TGGGAATCGCTGAAGGCGTCCGGCAATCCGGTCTACGAGACAGCTCGCGAGTTCGCCGACGTCTTCCCAGACAAGATCCCTGCGGAGCTGCCAGCGGATC
GCGGAGTGCGCCACGAGATTGACCTCGTGCCTGGATCGAAGTACTGCGTGACGCGGCAGTGGCCACTGCCGCGCGATCAAGTCAAGGCCATCGACGACTT
CTTCGAAGGCCGCCGCCAAGCCGGTCACGTCCGTGAGAGCATCTCGCCTCACTCGAGCCCGACCTTCTGTGTGAAGAAGGCTACTGGCGGGTGGCGCATC
GTACACGCCTTTAACAAGTTGAACGATGCCACCATCCCGGCGCAGACACCGATCCCGCGGAAGGACATGGTACTGGACTCCATGTCGGGCAGCGTCATTT
ACAGTGCCATCGACTTGACCGATGGCTTCTATCAGATCCTCATGAGAGAGAGCGATGTACCTCTCACGGCAGTCAGTACGCCCAGCGGTATGCTCTGGGA
GTGGCTCGTGATGCCCCAAGGTCTGAAGAACGCACCAGCCACATTTAATCGCATGGTGTCCCATGTGCTACGCCCGCTTCGTGACTTCGCTCCGAGTTAC
TTCGATGACATTTTTGTGCACAGTCACGCTGAAGAGGGTCTCAGCGCGATCGACGTGCATCTGCGGCACTTGAGGCAGGTCTTTCAAGTGATGAGAGAGA
ACAAGCTCTACGCGAATCTCAAGAAGTGTGTCTTCTGCGCGCCGGAAATTCCGGTGCTTGGGTGCTACGTGAGCAAAAACGGAGTCCGTGCTGACCCGGA
AAAAGTGTCGTCTATTTGCTCGTGGCCACCACCATCAAACCCCACTGAGCTGCGTCAGTGGTTGGGCCTCGCTAACTACTTGCACAAGTATACGAAGGGA
TATGCCGGCTTGATACAGCCACTGTCGTCGCTGTTGAAGAAAGACGCCACGTGGTCGTGGCGCCCCGAGCATCAAGTAGCCTTCGACTCGGTGAAGAAGA
GCTTGGCCTCGGCGCCAATACTGATGCTCCCAGATGACGCGAAACCGTTTCACGTCGTCTGCGACGCTAGCGACTTTGCTATCGGGTGCGCGCTCATGCA
GTTTGACAACGAAGGCCGCGAACGAGTCGTGAGCTATCAATCACGACAGATGAAGCCGGCCGAACGCAACTATCCCGTCCACGACAAGGAACTTCTTGCG
ATGCGATACGCTCTGATCAAATTCAGAGTGTACCTGCTCGGAGAACAGACGTTCGCGGTGTACACGGATCACGCATCGCTGCGCACAGCGATGAAGTCTC
CACATCTGTCTCAACGCATGGCACGATGGCTGTCGTTCTTCGCTGAGTACAACTTCGTCGTGCACTACAAGCCCGGCAAGAACAATATCCTCGCCGATGC
TCTGTCTCGGCGTCCAGACTATGATCCACGAGCGACGCGGGGTCGTCAAGTGATTGACGAAGACGAGGATGACGAAGATCACTGCGCGATGTGCTTGACA
TCAGGTGTCAACCTGATGAACGTGACCCCAGAAATGTCGCTACGCGAAGAAATCGCCGTTGCGTACAACGACGACGCGGTATATGCCGCCATCCTCGCAC
ATCTTCTTTCCCCCAGTGATAAAACACTCCGCGCGCTGCCGAATAACACGCGCAATCAGATTAACCGATATCAACTCGACGGCGATCTGCTGACGTACAG
CATCGATCGATTCGATGCTCCCCGCATCGCCATCCCGAACGACGATGATCTGCGCGCTCGGATCATCCACGAGTTCCACGACAGCCCTGTCGGTGGTCAC
TTGGGCCGCGAAAAGACGTTCGCGGCAGTATCCCGCGACTTCTACTGGCCCCACATGTACAAATGGGTGCGCAAGTGGGTCCGTACTTGTGAGATTTGCC
AGCGCGTGAAGCCGTCAAAGTCGTCGCAGGCTCCCCTGCGACCCCTGCCGATTGCAACTGAGGCGTGGCGCTCAGTGTCGATGGACTTCATCTTCGGGCT
TCCACCCGATGCCGACGGTCGGACTGGCGTCTTGGTGTTTGTGGATAGGTTCAGCAAGATGGTGCATCTCATTCCGGTGTCCGACACGATCACCGCGGCT
GAGTCCGCGGTGCATTTCGTTGACGCGGTCTTTCGACACCACGGCTTACCTGAATCGATCGTCTCTGACCGCGATCCGCGGTTCACGTCGGCATTCTGGT
CGAGTCTCTTCCAACTTCTGGGAACGAAGCTGCTCATGTCAACGGCGGCGCATCCGGAGACGGATGGTCAAACGGAGCGGGTCAACCGAGTCCTCGAAGA
TGTCCTTCGAAGTTACGCGACTTCGTTCACTAGTTGGAGCTCCTTTTTGCCGCTTGCCGAGTTTGCGCTAAACAACGCGGAACACGCATCGACGGGTCTG
ACCCCTTTTTTTGTAAATAACGCGCGGCACCCGCGCGTTCCCGCTCTGCTCGCCGTGGGCCACCCCACGATGCCTCGTGGCTCCACTCTGGGTGGGGAAG
GAAATGATGGTGCTGGTAGTACGAACACAGACACACCGATACCGATACCGGTATTACCAGTGGTGAGCACGGATGGCACACCACCACCACCAGCTCCCTT
GTCGAGTGCAGCCCACCAGTCCGTGACGCTGAATGCAGTCACCCGCGCGAAGTCGAGACGGACCCTTGCGACGCCGAACAACGCGGTGTCTTCACTGACA
GATTGGACTGCGCGCACGTTAATCAACCCTGGCCCGGCTACCGATCCCGTCGCAGCTAACTACGCGCCGAAGCCTCCGGCGCGTCCAGTCGATGATGCGG
CCGTCTCTGAGTTCGTGCTGCAGCGACAATCGGTCACCCGATTTGTACGAGATGCACTGCAAGAAGCAGTGGATAAGCAGAAGGAGAACGCCGACAAGCG
TGGGCGCAAGAACGTGGCTACATTTACGACAGGAGATCGTGTGCTCCTGTCGACAGACGGCATACGCTCTTCGGCCGTAACGAATCTTGGCGCGAGCAAA
CTCGCGCCGCGCTTTATTGGTCCCTTCAGGGTTACGAAGGTAATCGGTGATGCCTACACACTGGACATACCATCTTCCCTACGACTACACCCGACGTTCT
ACGTCGGGCGACTCAAGAAATACCACGCAGCTACAATCCCGTCGGCCCCGGAGCATCCGCCGGCGCAGCATGAACAGGACGTCCCTCCCGACGTGCGCGC
CTTGCCATCGAGCCATCCGAGCCATCCGTCCGCTCGCGCGGACGTGCTGCCGTCTGCGGCGCCCCGAACACGCGCCTTTCCAGCTCCCGCGTCCGTTGCA
GCAGTTCCGCACTCGTTTGGCGAGCAGCCGCTGCTGCACCCTCCGCCCGACGAGCCCGCTCCTCCGCCGTCTCAGCATCAAGCTGAGCGTCCCGCGCCCA
ATTCACTGCCTCGTCCACGTCATCCTGGGCGACCAGGACGCGAGCTCTATCGTCGCGAAGGTCCCCCGCCGATTGTAGACTCGGCTGGTGATATCCGCTG
GATCGTGGACCGTATTGTGGAGCACGAAGATCCACCTCGTACGTATGCCCATACCCGTACGAGTACGCGCTCCAAGCACGCGGTTCCGACCGCGCGACGT
TACCGAGTACGCTGGCTCGGGTTCGCTCCGGACGAAGATACGTGGGAGCCTCGCGCCGCACTCCTCCGGGATGTCCCGGATGTTGTCCGCGAATACGAGA
ATATGATCGTGAACGAGAACGACGCCGCAGACGGTCCTGCGGCGAACGAGAACGCGAACGCCGGCGTGCACGTCCCCGTGGCGGCGGAGGACTCCGCTGA
GTATCCCCGCGGCGTCCGACGCCGCGATTAGTAGACTGGGCCACCTCGGAGAGCGTGCGGCGATATTTGGCGATCCACGACTGTTCACTTTCGCTGAGCG
GATGCTCAGTGACGCGACGCAGCCATTCTTCCTCGGACAAACGCTCGGAACTCTCGCACGACGTGCAGCCTTCGCGCACGTGGACGTAACAATCATGATC
GGACTCCCAGGCGTTCTTGCAGACGCGTGCTCTCAGCTCGCTGAGAGAGTGTTCACCGACGACCTCCTCGCGACTGGTGAGCCAGGCGACGAAGTTGCTC
CCCTCCTGATGCATCCGGTTCCACCGGACGATCATTGCACACCACGACCGCTGCAGCGCATCGTGCGAGACACCCGTCAGCGACTTCCCCCGCAGCGCAC
GAAATCGGCGGAAGTAGCCCGTCATCTCCTCCAGGGATCCTGGAGACTTCGCTCCCGACAAATCGTACAACGCCCAAGGCTTGAGCTCCCGGTCCATAGC
GCGTGTCCGCTGGGTGAGTTCCAGCGGCGGGTCCTCCACGATCGCCGCCATAGGTGTTGCCCGCGCTATCTCCGCTGCCGAGTTGCTCGCGCGTGTTCCA
TCCGCAGGAGTCCCTGCGCTCGTGTCCGTCTGTCGCTCCATCTTGTCTCCGATCGCGCAATTCTGATTGTGCCTCTGCGGTTCGCAGAGGTTGCTGCTCG
TCGCCGTTGAGACCATCCCGTTGACGCCGCGTTCTCGCCGTTTCCCAGTTTTCTTTTCTTTCAGTTTTCTTTGCTCGCACTCACGGAAGCGTGAGTGCAA
CCTTAAGAGGGGGGTGATGTAATGGGCCCCTCCCATTTACATATGTAGGTAGATCTATATAGGTAGATCTACAAAGTAGAGACAAAGGCACGCGGCTAGC
GTGTGCCTCGTTGTCATCCTGCGATTGGTTGAAAGTGGGGAGCCAGACCCATTTTCGACCAATCAGGTGTCAACCTGCATTTGAGTGGTTCACATGGATC
CGAGGGCCACCCGCCCCGGTCCCAATAATAAACCAGAGTTGATTTTACCCTAGACTAAACACTTGGTCTCAGTATACCTGAGCTTATTGGACGCTTCCTC
ACCGCTACGTGTAAGCTAGTGACGGGCACTCACCTGGCCCGTTACA