Description :
From Genome Similarity Track
Location :
scaffold_336:31113- 32315
Transcript NameFunction/comments
Pl_105949thioredoxin H-type

Sequence
1202 bases(100 bases per row)
CTCTTGCATGGTCTCAAGCTCGCAGTTTAGGGTCGAAACAGGAGCAGCTAGTCTAGTTCCGAAGCAGTACTCTCATGACAAGGACTTCCAAACAGCGCAG
ACGTTTGCACTAATATATTCTACACTAGACCCGCATGTACCAGACTCTGCTTTGAATCCTGGTAAGTTTCCCGGTGCCTTGAGGTCTTGCGCAATGTATC
CAACTGGTCGGTTGTTTTTTCGCAACATGACCACAAAGCAATGCTACTAGCAGCACTGCCCCGCATGAAATGGTCTCCGATCTGAGACCCACAGCAATGG
TCACCACCTCGAGTCGCGACGTCGTAGCCCATCCTTGCCATTTAGGTAGGGCACACCAAAATCTGATTTTCCGGCGAGGAAGCGCAATCCAAAGCTACGA
TGTCACAAGGCTGCTGGGGCTGGTTCCTACGGAATGTGCTGCGCCAAGACGACGAGTATGTCCCTATCAACGTAAGTGGCTGTACCTCACATCCTCTTCA
CTCTGCTCTACTTACACCTACTTGTAGAGCCGTGTGATCCACGTGACGTCGGAGCAGCGGTTCAAGGAGCTTATTCAGACGTCCAAACGGTCGGTTGTCG
TAGGCTTTGCGGCCTCGTGGTGCAATCCCTGCCGCTACATCAGCCCCGTGTTCCATGAGCTTAGTGTCAAGTACCCGAGTACGATCTTCCTCAAAGTAGA
TGTGGACGATCTGAAGTCGGTGGCTAAGAATTGCGGCGTGTCGACCATGCCGACGTTCCAATTCTTCCGTGGTGGCATCAAATGCGACGAAATGCGCGGC
GCAGACAGGAATGGGCTCGAGGCGCGTATCCAGAAACACTATATTGAAATGGAACTGCCTGAGGAAGAGGGCAATGGCAAGTTGGCGTCTCCTGGTGACG
AAGGTCTGCGCCAGCGTAAGTCCCAAGTGGTGACGGTGGCGTCACAAGCTCATTGGGAGCAGCTCATACACCAGAACCAAGAATCGAGCAAAGCGGTGCG
TACTGTACAATGTGTATGTCGGCAAATACCTAGATATGAGATACCGGGTATCTTTGCCAACAAAGCGGTACAGGTGTTCATTCTGACGGAGTATCGTGTG
GTGTATTGGCTAGCTGGTGGTGGACTTTTGGGCGACGTGGTGCAAGCCGTGTGTGGAAATCGCACCGTTTTTTGAGGAATTGAGCACCCGGTTCCCTGCA
GC