Description :
From Genome Similarity Track
Location :
Scaffold_14:3111145- 3113719
Sequence
2574 bases(100 bases per row)
GCACGCGATTCACACTCTCGGTTTGTCGTCCGTCTGTGGATGATCCACAGTCGACATCGACAGCTGTGTTCTAAGAAGTGTAAACATTTTCTGCCAGAGC
CGCGCTGTAAAGCGTGAATCACGGTCCGAGTCAATGTCGAGCGGCATTCCATGGTGTCGGAGCACCATGTCAACAAACAGTCGTGCAGTCTGCAACGCCG
TGACTTAAGCCAGTACAGCAGCAAGATGAACCATCTTGCTGAATCGGTCATCAAAGACCACAATGCCAGTCCGCCCCTTGTTGTCTGGCGGAAGACCGAA
AACAAAGTCCATATAATGGACTGCCAACGGTGTCGGTAGTGATTGTAGTAAAGCCTGCAAATATGCAGCAGGCTTCACGCGTTGGCACACTTCGGAAGCA
CATACTTACTTGAGCACCCACTTGTACTGGTGCTTCCAGTAGAAGTGTCTCGTGAGAAGAGTGTATGTCTTCTCACGGCCCGAATGACCTGCCGTGGGGG
CATCGTGATACTCGTACATGATCCGCATACGCAGATCCTAATCATTCGGCACGACAATACGATCCGCATCGTTGTCCAATGCGCTTTAACGCAGCAGTCG
TTGGTGCACAGGATATCGGTGTGCACGAGCTCGCAGATGTGGCGACAACTTCCGACATGACGCGTCGGAAGGTGCTACGACATAGTCTAGCGGTTGTTTC
GCGTCTGCGTCACTGGCATACGCGTTTTTCCACGTCGTCGATCAATGTCGACGACGGAACACTTACTCGTTCGACGCCAATGCGATTGACGTCGGCTGTC
TTAACACCATAATCAGGTCGACGCGACAACGCGTAGGCCACCACATCAACCTTCCAGGTTTGTACTCAACCTGGAAGGTGTACTCCGCTAAGAACGATGA
CCATCTTGCCATTCGTTGCGAGATGTGCGATAACGTCACTGCCGTTCGCAGTTAAGCGCGGTCGGTGTAGACCACGAGTGGTCTTCTCCCAAGTACATAC
CTCATAGCAAGGAGCTCCTTCTCATGCACAGGGTAGTTACGCTCAGCTGGCTTCAGCTGAGCGTCACAAACGATGAGGAATGGGCGATCTTGGTCAGCCA
CTGCCAAGATCGGGGCCTCAGTCAAACCTTGCTTGACTGTATCGAAGGCCTGCTGACACTCACAGTCCAAATCTACTCAGCTTCCGTTTTCAGAAGCTGC
GACAGCGGGCGAATCTAGTCCGCGTAATTCTCAACGTACTTGAACAAGTACGTTGCAAGTCTAAGGAACAGTCTTAGTCCCTTCACGTTGGATGGCGTAG
GCCATTCACTGATAACTCTGACCTTTTCTGGGTCAGGGCGTACGCCGCTCTTACCGACAAGACACGCAAGGACGGGTTCTCGCCCGCCCCGAAGGTACAT
TTCTTCAGGTTCGCATAGAGCTTATGCTCACGCATAAGCCCTGGGCGGCCTTTGTGCACCCCAACGTCAGTCTTCCCGTCCACACTCCGGCTATGAGCGA
ACACGTCGTCGAAGTAGCTCGGTGCGAAGTCACGCACTGAGCGCAATAGATATGTAAGACATATATTGAAGGTTGCAGGGGCGTTCTTCAGTCTCTGCGG
CATTACGATCTACTCCCTAAGCATACCGCATAGAGTACTCACGCCGTGAGCGGAATATCCTTCTCACGCATCAGAAGCTGATAGAACCCGTCGTGTCGAT
CAAGAGCGCTATATATGGTGCTCCTGGCCATCGAATCGATGATGAAATATTTTTTGTAGTATCGGTATCTACGCCGGTATCATCGTACCGTTCATCTTGT
TGTAAGCATCAACGATGCGCCATCCGCCAGGTGGCTTCTTGACACAGAATGTTGGTGCGCTGTGCGGGGACTTTAATGTCCACACTTAACCCGCTTTACG
ACGACTTTCAAAGACGTTGTCGATTGCCTTTACTTGACCTCGCAATAGTGACCACTGCCGCGTCACAAAGGACTTCGTACCCGGCACGAGGTCGATCTCG
TGCTGTCTGCCCTTATCCTGCGGAAGCTCCGCAGGAATCGCTTACGGGAGCACATCCTTGTGCTCCAGAAGAACATCGTAGAAGGGCTCGACTTCAGTGA
GTCCCAGCTCTGCTCGTCGAAGCGCTGCTTCTTCGTCTTCGTGCTGAGCGTGTCCTTACTTTCAGCGGTATTCGCAGTGGAGTTGCCTCAACTCCTCCGC
TTTGCTTTCCATGATTTTGATATCCCATGTCTAGAAGCGACGTCAACGCTGACACACTCGTCGGAGGATTCTCCAGTTGCATTGACCGGTACTGGTGACC
AGTACTGGTCCACGTTAAGACGTTCAGCGTCTCGACGCACGGCATCGCTCGTATCGCCTCGGTCCCGGACCGAGACTTGCGCAGCTTTTGTCGATTGGGC
CGTCTTTTAATCTTGTGAAGCCCGACTTCTTATGTTTCTCGTGCAGGCCCGGTCTTGGACGGATTTCCATTGTAACCGACGGCGGATTCTTTCCGCGGAC
GCGAATGATCAAGTCCGGCTTGATTGCATTCCGCTTCGTCGTGCAGCCCGGCTACACGCGAGCACGCGATCGTT