Description :
From Genome Similarity Track
Location :
Scaffold_82:31110- 32491
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18268hypothetical protein

Sequence
1381 bases(100 bases per row)
CCTTTGCCCGTCTCGCAATCCACACATTCACCGACATAGCGTTGCACGCTCTTGTGCAGTCCTCTCCAGTGGAACCTATCCCGGATCCGCTGATAAGTAC
GGCCAATACATTGATGCCCACCCTCCAAGCTGAGATGGTAGTGATGTAGGATATCTTGATGTAGAGCCTCCGGCATTCTCAATCTCATCAATCCGTCGCG
GTCTTCATCACTACGCTTAGTAGGAGGATAATAGAATAGTAGATCGTTTAGATCCACTTTGTAATATGTGGTGACGGGACTAAACGATTTGGCCACTTCT
CGACTTAGATCGGACACATCTCCAATCAGGTATTTCTTCAAGCTCGAGATCCACGCCTCCTCACCTTGCGCCTTCTCGATCCAATCTATACGGAGTCCTC
TCACATATTGTTCTTACAGGATCTGGAGTGTAGACGCCGTCCTAGCTCTTGATTGGAAAGTTACAGCGGATATCTGCGAGGCTTAGACTTCAGATCGCGC
CACGAAACCCTCCTCCAACCGGTTCACTGTAATGGTATCTTGATAGTCGAATTCTACCTCTACCTCAATCTTGCATTGTTTCTGCAATGCCGAACTCGCT
AGGCTGTCTGCACTGGCGTTCCAATCACGCTTGACATGCACCAAGTCATCACCTATCCACTGTCGTATCCGATTCAGTACTCATTGCATTAGCATCGTCA
ATCCGGATACCTTACAGTCGATCTCAACTCGTACCTGCCGGGCCATCAGATTGGAATCACCACAGATCACCAATTGCTTCTGATCGGCCTCACTCAGCTG
ACCCAGACCCAACAGCAGCCCATGATATTCCGCTTCGTTGACTGTAAGTCCCTCACCGTACGCGGATCTGGCTTTCAATACCTTCACTCGGGTAATTTCC
ACAAAGTCGCACGGTAGGCACCTCCCCCATTATTCACATGAGCAGGTCCTCGTCAGGTTGTACCGTCGGGATCACAGTCCGGATCTATCGGCTGGGCCCT
TTTCTGGGCGTGATCCGGGTGAGCACCTCGTCTACCTTTGACCGGGCGTGATTCTTGCTGCATGAACTCCCAAGATCTCGTCTTCTCCCTGTAAATACTC
CGCGATCTCCAAAGTTCATGACGAGAGCAGAGCAGTCCACTGGCCAAGGCACCCATGGAGGCCGGTTGATTTGAAAAGCCAACCTGTAGTGCTGGGTCAG
CGTCCGGATAGATCGCCCCACGAGCAGATTGCAGGACTCGCAGAAGTACAAGAATCTTGTCTCTATGACACCATAGTTGAGCTGATTAGATTCGAGCGTT
CGACTTTGTCAAAGTGTCTCGATGATAGGTCCCGTCGTGTTCCTGTACCAGAATAGCCGAGCCGGCCCAATCGCTGGTTTA